diff options
author | Antonio Cunei <antonio.cunei@epfl.ch> | 2011-11-07 09:55:10 +0000 |
---|---|---|
committer | Antonio Cunei <antonio.cunei@epfl.ch> | 2011-11-07 09:55:10 +0000 |
commit | da929738ccfcf21cc3d8fdb9ce7734e59c6847f0 (patch) | |
tree | 90e335ca1fb60fde22ad345df72aeb0f08aace22 /test/pending/shootout/fasta.scala | |
parent | c4e1b28cf79f73e4f8972263efb85ee879c39ebd (diff) | |
download | scala-da929738ccfcf21cc3d8fdb9ce7734e59c6847f0.tar.gz scala-da929738ccfcf21cc3d8fdb9ce7734e59c6847f0.tar.bz2 scala-da929738ccfcf21cc3d8fdb9ce7734e59c6847f0.zip |
Backport of r25948
Diffstat (limited to 'test/pending/shootout/fasta.scala')
-rw-r--r-- | test/pending/shootout/fasta.scala | 162 |
1 files changed, 162 insertions, 0 deletions
diff --git a/test/pending/shootout/fasta.scala b/test/pending/shootout/fasta.scala new file mode 100644 index 0000000000..16b6f42201 --- /dev/null +++ b/test/pending/shootout/fasta.scala @@ -0,0 +1,162 @@ +/* The Computer Language Shootout + http://shootout.alioth.debian.org/ + contributed by Isaac Gouy +*/ + +import java.io._ + +object fasta { + def main(args: Array[String]) = { + + val ALU = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + + val _IUB = Array( + Pair('a', 0.27), + Pair('c', 0.12), + Pair('g', 0.12), + Pair('t', 0.27), + + Pair('B', 0.02), + Pair('D', 0.02), + Pair('H', 0.02), + Pair('K', 0.02), + Pair('M', 0.02), + Pair('N', 0.02), + Pair('R', 0.02), + Pair('S', 0.02), + Pair('V', 0.02), + Pair('W', 0.02), + Pair('Y', 0.02) + ) + + val IUB = makeCumulative(_IUB) + + val _HomoSapiens = Array( + Pair('a', 0.3029549426680), + Pair('c', 0.1979883004921), + Pair('g', 0.1975473066391), + Pair('t', 0.3015094502008) + ) + + val HomoSapiens = makeCumulative(_HomoSapiens) + + + val n = Integer parseInt(args(0)) + val s = new FastaOutputStream(System.out) + + s.writeDescription("ONE Homo sapiens alu") + s.writeRepeatingSequence(ALU,n*2) + + s.writeDescription("TWO IUB ambiguity codes") + s.writeRandomSequence(IUB,n*3) + + s.writeDescription("THREE Homo sapiens frequency") + s.writeRandomSequence(HomoSapiens,n*5) + + s.close + } + + def makeCumulative(a: Array[Pair[Char,double]]) = { + var cp = 0.0 + a map (frequency => + frequency match { + case Pair(code,percent) => + cp = cp + percent; new Frequency(code.toByte,cp) + } + ) + } + +} + + +// We could use instances of Pair or Tuple2 but specific labels +// make the code more readable than index numbers + +class Frequency(_code: byte, _percent: double){ + var code = _code; var percent = _percent; +} + + +// extend the Java BufferedOutputStream class + +class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) { + + private val LineLength = 60 + private val nl = '\n'.toByte + + def writeDescription(desc: String) = { write( (">" + desc + "\n").getBytes ) } + + def writeRepeatingSequence(_alu: String, length: int) = { + val alu = _alu.getBytes + var n = length; var k = 0; val kn = alu.length; + + while (n > 0) { + val m = if (n < LineLength) n else LineLength + + var i = 0 + while (i < m){ + if (k == kn) k = 0 + val b = alu(k) + if (count < buf.length){ buf(count) = b; count = count + 1 } + else { write(b) } // flush buffer + k = k+1 + i = i+1 + } + + write(nl) + n = n - LineLength + } + + } + + def writeRandomSequence(distribution: Array[Frequency], length: int) = { + var n = length + while (n > 0) { + val m = if (n < LineLength) n else LineLength + + var i = 0 + while (i < m){ + val b = selectRandom(distribution) + if (count < buf.length){ buf(count) = b; count = count + 1 } + else { write(b) } // flush buffer + i = i+1 + } + + if (count < buf.length){ buf(count) = nl; count = count + 1 } + else { write(nl) } // flush buffer + n = n - LineLength + } + } + + private def selectRandom(distribution: Array[Frequency]): Byte = { + val n = distribution.length + val r = RandomNumber scaledTo(1.0) + + var i = 0 + while (i < n) { + if (r < distribution(i).percent) return distribution(i).code + i = i+1 + } + return distribution(n-1).code + } +} + + +object RandomNumber { + private val IM = 139968 + private val IA = 3877 + private val IC = 29573 + private var seed = 42 + + def scaledTo(max: double) = { + seed = (seed * IA + IC) % IM + max * seed / IM + } +} |