summaryrefslogtreecommitdiff
path: root/test/pending/shootout
diff options
context:
space:
mode:
authorDen Shabalin <den.shabalin@gmail.com>2013-11-13 15:33:33 +0100
committerDen Shabalin <den.shabalin@gmail.com>2013-11-20 16:06:30 +0100
commitb004c3ddb38f8e690a0895a51ad0c83ff57a01e7 (patch)
tree0c31f83d2e039db4c2ead7a3280aaabc78671333 /test/pending/shootout
parentc243435f113615b2f7407fbd683c93ec16c73749 (diff)
downloadscala-b004c3ddb38f8e690a0895a51ad0c83ff57a01e7.tar.gz
scala-b004c3ddb38f8e690a0895a51ad0c83ff57a01e7.tar.bz2
scala-b004c3ddb38f8e690a0895a51ad0c83ff57a01e7.zip
deprecate Pair and Triple
Diffstat (limited to 'test/pending/shootout')
-rw-r--r--test/pending/shootout/fasta.scala64
-rw-r--r--test/pending/shootout/revcomp.scala-2.scala18
-rw-r--r--test/pending/shootout/revcomp.scala-3.scala40
3 files changed, 61 insertions, 61 deletions
diff --git a/test/pending/shootout/fasta.scala b/test/pending/shootout/fasta.scala
index 8b711083a5..ae99ba5936 100644
--- a/test/pending/shootout/fasta.scala
+++ b/test/pending/shootout/fasta.scala
@@ -5,7 +5,7 @@
import java.io._
-object fasta {
+object fasta {
def main(args: Array[String]) = {
val ALU =
@@ -18,31 +18,31 @@ object fasta {
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
val _IUB = Array(
- Pair('a', 0.27),
- Pair('c', 0.12),
- Pair('g', 0.12),
- Pair('t', 0.27),
-
- Pair('B', 0.02),
- Pair('D', 0.02),
- Pair('H', 0.02),
- Pair('K', 0.02),
- Pair('M', 0.02),
- Pair('N', 0.02),
- Pair('R', 0.02),
- Pair('S', 0.02),
- Pair('V', 0.02),
- Pair('W', 0.02),
- Pair('Y', 0.02)
+ ('a', 0.27),
+ ('c', 0.12),
+ ('g', 0.12),
+ ('t', 0.27),
+
+ ('B', 0.02),
+ ('D', 0.02),
+ ('H', 0.02),
+ ('K', 0.02),
+ ('M', 0.02),
+ ('N', 0.02),
+ ('R', 0.02),
+ ('S', 0.02),
+ ('V', 0.02),
+ ('W', 0.02),
+ ('Y', 0.02)
)
val IUB = makeCumulative(_IUB)
val _HomoSapiens = Array(
- Pair('a', 0.3029549426680),
- Pair('c', 0.1979883004921),
- Pair('g', 0.1975473066391),
- Pair('t', 0.3015094502008)
+ ('a', 0.3029549426680),
+ ('c', 0.1979883004921),
+ ('g', 0.1975473066391),
+ ('t', 0.3015094502008)
)
val HomoSapiens = makeCumulative(_HomoSapiens)
@@ -61,15 +61,15 @@ object fasta {
s.writeRandomSequence(HomoSapiens,n*5)
s.close
- }
+ }
- def makeCumulative(a: Array[Pair[Char,Double]]) = {
+ def makeCumulative(a: Array[Tuple2[Char,Double]]) = {
var cp = 0.0
a map (frequency =>
- frequency match {
- case Pair(code,percent) =>
- cp = cp + percent; new Frequency(code.toByte,cp)
- }
+ frequency match {
+ case (code,percent) =>
+ cp = cp + percent; new Frequency(code.toByte,cp)
+ }
)
}
@@ -79,7 +79,7 @@ object fasta {
// We could use instances of Pair or Tuple2 but specific labels
// make the code more readable than index numbers
-class Frequency(_code: Byte, _percent: Double){
+class Frequency(_code: Byte, _percent: Double){
var code = _code; var percent = _percent;
}
@@ -101,13 +101,13 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
val m = if (n < LineLength) n else LineLength
var i = 0
- while (i < m){
+ while (i < m){
if (k == kn) k = 0
val b = alu(k)
if (count < buf.length){ buf(count) = b; count = count + 1 }
else { write(b) } // flush buffer
k = k+1
- i = i+1
+ i = i+1
}
write(nl)
@@ -122,11 +122,11 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
val m = if (n < LineLength) n else LineLength
var i = 0
- while (i < m){
+ while (i < m){
val b = selectRandom(distribution)
if (count < buf.length){ buf(count) = b; count = count + 1 }
else { write(b) } // flush buffer
- i = i+1
+ i = i+1
}
if (count < buf.length){ buf(count) = nl; count = count + 1 }
diff --git a/test/pending/shootout/revcomp.scala-2.scala b/test/pending/shootout/revcomp.scala-2.scala
index 92260ad021..03fb25af1b 100644
--- a/test/pending/shootout/revcomp.scala-2.scala
+++ b/test/pending/shootout/revcomp.scala-2.scala
@@ -6,7 +6,7 @@
import java.io._
import scala.collection.mutable.Stack
-object revcomp {
+object revcomp {
val IUB = IUBCodeComplements
@@ -16,7 +16,7 @@ object revcomp {
val a: Array[Byte] = new Array( 'z'.toByte )
for (indexValue <- code zip comp)
- indexValue match { case Pair(i,v) => a(i) = v }
+ indexValue match { case (i,v) => a(i) = v }
a
}
@@ -49,18 +49,18 @@ object revcomp {
if (desc.length > 0) complementReverseWrite(desc, lines, w)
w.close
- }
+ }
- def complementReverseWrite(desc: String, lines: LineStack,
+ def complementReverseWrite(desc: String, lines: LineStack,
w: BufferedOutputStream) = {
def inplaceComplementReverse(b: Array[Byte]) = {
- var i = 0
+ var i = 0
var j = b.length - 1
while (i < j){
- val swap = b(i)
- b(i) = IUB( b(j) )
+ val swap = b(i)
+ b(i) = IUB( b(j) )
b(j) = IUB( swap )
i = i + 1
j = j - 1
@@ -79,11 +79,11 @@ object revcomp {
while (!lines.isEmpty) {
val line = lines.pop
inplaceComplementReverse(line)
-
+
if (isSplitLine){
if (isFirstLine){ w.write(line); isFirstLine = false }
else { w.write(line,0,n-k); w.write(nl); w.write(line,n-k,k) }
- }
+ }
else { w.write(line); w.write(nl) }
}
if (isSplitLine && !isFirstLine) w.write(nl)
diff --git a/test/pending/shootout/revcomp.scala-3.scala b/test/pending/shootout/revcomp.scala-3.scala
index ae12f0499b..39a0409127 100644
--- a/test/pending/shootout/revcomp.scala-3.scala
+++ b/test/pending/shootout/revcomp.scala-3.scala
@@ -6,7 +6,7 @@
import java.io._
import scala.collection.mutable.Stack
-object revcomp {
+object revcomp {
def main(args: Array[String]) = {
val out = new FastaOutputStream(System.out)
val in = new FastaInputStream(System.in)
@@ -17,12 +17,12 @@ object revcomp {
in.close
out.close
- }
+ }
}
trait FastaByteStream {
- val nl = '\n'.toByte
+ val nl = '\n'.toByte
type Line = Array[Byte]
type LineStack = Stack[Line]
@@ -31,13 +31,13 @@ trait FastaByteStream {
// extend the Java BufferedInputStream class
-final class FastaInputStream(in: InputStream)
+final class FastaInputStream(in: InputStream)
extends BufferedInputStream(in) with FastaByteStream {
val gt = '>'.toByte
val sc = ';'.toByte
- def readSequenceStack(): Pair[Line,LineStack] = {
+ def readSequenceStack(): Tuple2[Line,LineStack] = {
var header: Line = null
val lines: LineStack = new Stack
@@ -49,14 +49,14 @@ final class FastaInputStream(in: InputStream)
header = line
} else {
pos = pos - line.length - 1 // reposition to start of line
- return Pair(header,lines)
+ return (header,lines)
}
} else {
if (c != sc) lines push line // ';'
}
line = readLine()
}
- return Pair(header,lines)
+ return (header,lines)
}
def readLine() = {
@@ -65,7 +65,7 @@ final class FastaInputStream(in: InputStream)
else {
mark(128) // mark the start of the line
if (count == 0) read() // fill buffer
-
+
var i = markpos
while (i < count && buf(i) != nl) i = i + 1
@@ -74,11 +74,11 @@ final class FastaInputStream(in: InputStream)
while (i < count && buf(i) != nl) i = i + 1
}
- if (i < count){
+ if (i < count){
bytes = new Array(i - markpos)
System.arraycopy(buf, markpos, bytes, 0, i - markpos);
pos = i+1
- }
+ }
}
bytes
}
@@ -87,7 +87,7 @@ final class FastaInputStream(in: InputStream)
// extend the Java BufferedOutputStream class
-final class FastaOutputStream(in: OutputStream)
+final class FastaOutputStream(in: OutputStream)
extends BufferedOutputStream(in) with FastaByteStream {
private val IUB = IUBCodeComplements
@@ -98,19 +98,19 @@ final class FastaOutputStream(in: OutputStream)
val iub: Array[Byte] = new Array( 'z'.toByte )
for (indexValue <- code zip comp)
- indexValue match { case Pair(i,v) => iub(i) = v }
+ indexValue match { case (i,v) => iub(i) = v }
iub
}
- def writeReverseComplement(sequence: Pair[Line,LineStack]) = {
+ def writeReverseComplement(sequence: Tuple2[Line,LineStack]) = {
def inplaceComplementReverse(b: Array[Byte]) = {
- var i = 0
+ var i = 0
var j = b.length - 1
while (i < j){
- val swap = b(i)
- b(i) = IUB( b(j) )
+ val swap = b(i)
+ b(i) = IUB( b(j) )
b(j) = IUB( swap )
i = i + 1
j = j - 1
@@ -119,7 +119,7 @@ final class FastaOutputStream(in: OutputStream)
}
sequence match {
- case Pair(header,lines) => {
+ case (header,lines) => {
write(header); write(nl)
@@ -131,11 +131,11 @@ final class FastaOutputStream(in: OutputStream)
while (!lines.isEmpty) {
val line = lines.pop
inplaceComplementReverse(line)
-
+
if (isSplitLine){
- if (isFirstLine){ write(line); isFirstLine = false }
+ if (isFirstLine){ write(line); isFirstLine = false }
else { write(line,0,LineLength-k); write(nl); write(line,LineLength-k,k) }
- }
+ }
else { write(line); write(nl) }
}