deprecate Pair and Triple

5 files changed, 72 insertions, 72 deletions

diff --git a/test/pending/run/reify_callccinterpreter.scala b/test/pending/run/reify_callccinterpreter.scala
index d9f7736769..82c70da28f 100644
--- a/test/pending/run/reify_callccinterpreter.scala
+++ b/test/pending/run/reify_callccinterpreter.scala
@@ -43,15 +43,15 @@ object Test extends App {
       override def toString() = "<function>"
     }
 
-    type Environment = List[Pair[Name, Value]];
+    type Environment = List[Tuple2[Name, Value]];
 
     def lookup(x: Name, e: Environment): M[Value] = e match {
       case List() => unitM(Wrong)
-      case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+      case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
     }
 
-    def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
-      case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+    def add(a: Value, b: Value): M[Value] = (a, b) match {
+      case (Num(m), Num(n)) => unitM(Num(m + n))
       case _ => unitM(Wrong)
     }
 
@@ -67,12 +67,12 @@ object Test extends App {
            b <- interp(r, e);
            c <- add(a, b))
                         yield c
-      case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+      case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
       case App(f, t) => for (a <- interp(f, e);
            b <- interp(t, e);
            c <- apply(a, b))
             yield c
-      case Ccc(x, t) => callCC(k => interp(t, Pair(x, Fun(k)) :: e))
+      case Ccc(x, t) => callCC(k => interp(t, (x, Fun(k)) :: e))
     }
 
     def test(t: Term): String = showM(interp(t, List()))
diff --git a/test/pending/run/reify_simpleinterpreter.scala b/test/pending/run/reify_simpleinterpreter.scala
index 6cf87ea7c5..1f6d6c8da7 100644
--- a/test/pending/run/reify_simpleinterpreter.scala
+++ b/test/pending/run/reify_simpleinterpreter.scala
@@ -32,15 +32,15 @@ object Test extends App {
       override def toString() = "<function>"
     }
 
-    type Environment = List[Pair[Name, Value]]
+    type Environment = List[Tuple2[Name, Value]]
 
     def lookup(x: Name, e: Environment): M[Value] = e match {
       case List() => unitM(Wrong)
-      case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+      case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
     }
 
-    def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
-      case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+    def add(a: Value, b: Value): M[Value] = (a, b) match {
+      case (Num(m), Num(n)) => unitM(Num(m + n))
       case _ => unitM(Wrong)
     }
 
@@ -56,7 +56,7 @@ object Test extends App {
            b <- interp(r, e);
            c <- add(a, b))
                         yield c
-      case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+      case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
       case App(f, t) => for (a <- interp(f, e);
            b <- interp(t, e);
            c <- apply(a, b))
diff --git a/test/pending/shootout/fasta.scala b/test/pending/shootout/fasta.scala
index 8b711083a5..ae99ba5936 100644
--- a/test/pending/shootout/fasta.scala
+++ b/test/pending/shootout/fasta.scala
@@ -5,7 +5,7 @@
 
 import java.io._
 
-object fasta { 
+object fasta {
    def main(args: Array[String]) = {
 
       val ALU =
@@ -18,31 +18,31 @@ object fasta {
          "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
 
       val _IUB = Array(
-         Pair('a', 0.27), 
-         Pair('c', 0.12), 
-         Pair('g', 0.12), 
-         Pair('t', 0.27), 
-
-         Pair('B', 0.02), 
-         Pair('D', 0.02),
-         Pair('H', 0.02), 
-         Pair('K', 0.02), 
-         Pair('M', 0.02),
-         Pair('N', 0.02), 
-         Pair('R', 0.02), 
-         Pair('S', 0.02),
-         Pair('V', 0.02), 
-         Pair('W', 0.02), 
-         Pair('Y', 0.02)
+         ('a', 0.27),
+         ('c', 0.12),
+         ('g', 0.12),
+         ('t', 0.27),
+
+         ('B', 0.02),
+         ('D', 0.02),
+         ('H', 0.02),
+         ('K', 0.02),
+         ('M', 0.02),
+         ('N', 0.02),
+         ('R', 0.02),
+         ('S', 0.02),
+         ('V', 0.02),
+         ('W', 0.02),
+         ('Y', 0.02)
       )
 
       val IUB = makeCumulative(_IUB)
 
       val _HomoSapiens = Array(
-         Pair('a', 0.3029549426680), 
-         Pair('c', 0.1979883004921),
-         Pair('g', 0.1975473066391), 
-         Pair('t', 0.3015094502008)
+         ('a', 0.3029549426680),
+         ('c', 0.1979883004921),
+         ('g', 0.1975473066391),
+         ('t', 0.3015094502008)
       )
 
       val HomoSapiens = makeCumulative(_HomoSapiens)
@@ -61,15 +61,15 @@ object fasta {
       s.writeRandomSequence(HomoSapiens,n*5)
 
       s.close
-   } 
+   }
 
-   def makeCumulative(a: Array[Pair[Char,Double]]) = {
+   def makeCumulative(a: Array[Tuple2[Char,Double]]) = {
       var cp = 0.0
       a map (frequency =>
-         frequency match { 
-            case Pair(code,percent) => 
-               cp = cp + percent; new Frequency(code.toByte,cp) 
-         } 
+         frequency match {
+            case (code,percent) =>
+               cp = cp + percent; new Frequency(code.toByte,cp)
+         }
       )
    }
 
@@ -79,7 +79,7 @@ object fasta {
 // We could use instances of Pair or Tuple2 but specific labels
 // make the code more readable than index numbers
 
-class Frequency(_code: Byte, _percent: Double){ 
+class Frequency(_code: Byte, _percent: Double){
    var code = _code; var percent = _percent;
 }
 
@@ -101,13 +101,13 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
          val m = if (n < LineLength) n else LineLength
 
          var i = 0
-         while (i < m){ 
+         while (i < m){
             if (k == kn) k = 0
             val b = alu(k)
             if (count < buf.length){ buf(count) = b; count = count + 1 }
             else { write(b) } // flush buffer
             k = k+1
-            i = i+1 
+            i = i+1
          }
 
          write(nl)
@@ -122,11 +122,11 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
          val m = if (n < LineLength) n else LineLength
 
          var i = 0
-         while (i < m){ 
+         while (i < m){
             val b = selectRandom(distribution)
             if (count < buf.length){ buf(count) = b; count = count + 1 }
             else { write(b) } // flush buffer
-            i = i+1 
+            i = i+1
          }
 
          if (count < buf.length){ buf(count) = nl; count = count + 1 }
diff --git a/test/pending/shootout/revcomp.scala-2.scala b/test/pending/shootout/revcomp.scala-2.scala
index 92260ad021..03fb25af1b 100644
--- a/test/pending/shootout/revcomp.scala-2.scala
+++ b/test/pending/shootout/revcomp.scala-2.scala
@@ -6,7 +6,7 @@
 import java.io._
 import scala.collection.mutable.Stack
 
-object revcomp { 
+object revcomp {
 
    val IUB = IUBCodeComplements
 
@@ -16,7 +16,7 @@ object revcomp {
       val a: Array[Byte] = new Array( 'z'.toByte )
 
       for (indexValue <- code zip comp)
-         indexValue match { case Pair(i,v) => a(i) = v }
+         indexValue match { case (i,v) => a(i) = v }
 
       a
    }
@@ -49,18 +49,18 @@ object revcomp {
 
       if (desc.length > 0) complementReverseWrite(desc, lines, w)
       w.close
-   } 
+   }
 
 
-   def complementReverseWrite(desc: String, lines: LineStack, 
+   def complementReverseWrite(desc: String, lines: LineStack,
          w: BufferedOutputStream) = {
 
       def inplaceComplementReverse(b: Array[Byte]) = {
-         var i = 0 
+         var i = 0
          var j = b.length - 1
          while (i < j){
-            val swap = b(i) 
-            b(i) = IUB( b(j) ) 
+            val swap = b(i)
+            b(i) = IUB( b(j) )
             b(j) = IUB( swap )
             i = i + 1
             j = j - 1
@@ -79,11 +79,11 @@ object revcomp {
       while (!lines.isEmpty) {
         val line = lines.pop
         inplaceComplementReverse(line)
-        
+
         if (isSplitLine){
            if (isFirstLine){ w.write(line); isFirstLine = false }
            else { w.write(line,0,n-k); w.write(nl); w.write(line,n-k,k) }
-        } 
+        }
         else { w.write(line); w.write(nl) }
       }
       if (isSplitLine && !isFirstLine) w.write(nl)
diff --git a/test/pending/shootout/revcomp.scala-3.scala b/test/pending/shootout/revcomp.scala-3.scala
index ae12f0499b..39a0409127 100644
--- a/test/pending/shootout/revcomp.scala-3.scala
+++ b/test/pending/shootout/revcomp.scala-3.scala
@@ -6,7 +6,7 @@
 import java.io._
 import scala.collection.mutable.Stack
 
-object revcomp { 
+object revcomp {
    def main(args: Array[String]) = {
       val out = new FastaOutputStream(System.out)
       val in = new FastaInputStream(System.in)
@@ -17,12 +17,12 @@ object revcomp {
 
       in.close
       out.close
-   } 
+   }
 }
 
 
 trait FastaByteStream {
-   val nl = '\n'.toByte  
+   val nl = '\n'.toByte
 
    type Line = Array[Byte]
    type LineStack = Stack[Line]
@@ -31,13 +31,13 @@ trait FastaByteStream {
 
 // extend the Java BufferedInputStream class
 
-final class FastaInputStream(in: InputStream) 
+final class FastaInputStream(in: InputStream)
       extends BufferedInputStream(in) with FastaByteStream {
 
    val gt = '>'.toByte
    val sc = ';'.toByte
 
-   def readSequenceStack(): Pair[Line,LineStack] = {
+   def readSequenceStack(): Tuple2[Line,LineStack] = {
       var header: Line = null
       val lines: LineStack = new Stack
 
@@ -49,14 +49,14 @@ final class FastaInputStream(in: InputStream)
                header = line
             } else {
                pos = pos - line.length - 1   // reposition to start of line
-               return Pair(header,lines)
+               return (header,lines)
             }
          } else {
             if (c != sc) lines push line       // ';'
          }
          line = readLine()
       }
-      return Pair(header,lines)
+      return (header,lines)
    }
 
    def readLine() = {
@@ -65,7 +65,7 @@ final class FastaInputStream(in: InputStream)
       else {
          mark(128)                      // mark the start of the line
          if (count == 0) read()         // fill buffer
-        
+
          var i = markpos
          while (i < count && buf(i) != nl) i = i + 1
 
@@ -74,11 +74,11 @@ final class FastaInputStream(in: InputStream)
             while (i < count && buf(i) != nl) i = i + 1
          }
 
-         if (i < count){     
+         if (i < count){
             bytes = new Array(i - markpos)
             System.arraycopy(buf, markpos, bytes, 0, i - markpos);
             pos = i+1
-         }          
+         }
       }
       bytes
    }
@@ -87,7 +87,7 @@ final class FastaInputStream(in: InputStream)
 
 // extend the Java BufferedOutputStream class
 
-final class FastaOutputStream(in: OutputStream) 
+final class FastaOutputStream(in: OutputStream)
       extends BufferedOutputStream(in) with FastaByteStream {
 
    private val IUB = IUBCodeComplements
@@ -98,19 +98,19 @@ final class FastaOutputStream(in: OutputStream)
       val iub: Array[Byte] = new Array( 'z'.toByte )
 
       for (indexValue <- code zip comp)
-         indexValue match { case Pair(i,v) => iub(i) = v }
+         indexValue match { case (i,v) => iub(i) = v }
 
       iub
    }
 
-   def writeReverseComplement(sequence: Pair[Line,LineStack]) = {
+   def writeReverseComplement(sequence: Tuple2[Line,LineStack]) = {
 
       def inplaceComplementReverse(b: Array[Byte]) = {
-         var i = 0 
+         var i = 0
          var j = b.length - 1
          while (i < j){
-            val swap = b(i) 
-            b(i) = IUB( b(j) ) 
+            val swap = b(i)
+            b(i) = IUB( b(j) )
             b(j) = IUB( swap )
             i = i + 1
             j = j - 1
@@ -119,7 +119,7 @@ final class FastaOutputStream(in: OutputStream)
       }
 
       sequence match {
-         case Pair(header,lines) => {
+         case (header,lines) => {
 
             write(header); write(nl)
 
@@ -131,11 +131,11 @@ final class FastaOutputStream(in: OutputStream)
             while (!lines.isEmpty) {
                val line = lines.pop
                inplaceComplementReverse(line)
-        
+
                if (isSplitLine){
-                  if (isFirstLine){ write(line); isFirstLine = false } 
+                  if (isFirstLine){ write(line); isFirstLine = false }
                   else { write(line,0,LineLength-k); write(nl); write(line,LineLength-k,k) }
-               } 
+               }
                else { write(line); write(nl) }
             }