summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
-rw-r--r--docs/examples/fors.scala2
-rw-r--r--docs/examples/iterators.scala4
-rw-r--r--docs/examples/jolib/Ref.scala8
-rw-r--r--docs/examples/jolib/parallelOr.scala22
-rw-r--r--docs/examples/monads/callccInterpreter.scala18
-rw-r--r--docs/examples/monads/directInterpreter.scala14
-rw-r--r--docs/examples/monads/errorInterpreter.scala10
-rw-r--r--docs/examples/monads/simpleInterpreter.scala14
-rw-r--r--docs/examples/monads/stateInterpreter.scala24
-rw-r--r--docs/examples/patterns.scala8
-rw-r--r--docs/examples/pilib/elasticBuffer.scala8
-rw-r--r--docs/examples/pilib/handover.scala38
-rw-r--r--docs/examples/pilib/piNat.scala16
-rw-r--r--docs/examples/typeinf.scala50
-rw-r--r--src/actors/scala/actors/Future.scala14
-rw-r--r--src/actors/scala/actors/remote/NetKernel.scala8
-rw-r--r--src/actors/scala/actors/remote/Proxy.scala4
-rw-r--r--src/actors/scala/actors/remote/RemoteActor.scala4
-rw-r--r--src/actors/scala/actors/remote/TcpService.scala8
-rw-r--r--src/compiler/scala/reflect/macros/compiler/Resolvers.scala2
-rw-r--r--src/compiler/scala/tools/ant/ScalaTool.scala4
-rw-r--r--src/compiler/scala/tools/ant/sabbus/Compilers.scala2
-rw-r--r--src/compiler/scala/tools/nsc/ast/parser/Parsers.scala16
-rw-r--r--src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala2
-rw-r--r--src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala2
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala8
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala4
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala2
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala4
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala22
-rw-r--r--src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala6
-rw-r--r--src/compiler/scala/tools/nsc/plugins/Plugin.scala2
-rw-r--r--src/compiler/scala/tools/nsc/reporters/Reporter.scala6
-rw-r--r--src/compiler/scala/tools/nsc/scratchpad/Mixer.scala99
-rw-r--r--src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala21
-rw-r--r--src/compiler/scala/tools/nsc/typechecker/NamesDefaults.scala9
-rw-r--r--src/compiler/scala/tools/nsc/typechecker/Typers.scala2
-rw-r--r--src/compiler/scala/tools/nsc/util/package.scala35
-rw-r--r--src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala20
-rw-r--r--src/eclipse/README.md7
-rw-r--r--src/interactive/scala/tools/nsc/interactive/CompilerControl.scala37
-rw-r--r--src/interactive/scala/tools/nsc/interactive/ContextTrees.scala64
-rw-r--r--src/interactive/scala/tools/nsc/interactive/Global.scala13
-rw-r--r--src/interactive/scala/tools/nsc/interactive/REPL.scala55
-rw-r--r--src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala201
-rw-r--r--src/interactive/scala/tools/nsc/interactive/tests/InteractiveTest.scala2
-rw-r--r--src/interactive/scala/tools/nsc/interactive/tests/core/AskCommand.scala19
-rw-r--r--src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala43
-rw-r--r--src/interactive/scala/tools/nsc/interactive/tests/core/TestMarker.scala4
-rw-r--r--src/library/scala/Predef.scala6
-rw-r--r--src/library/scala/Responder.scala2
-rw-r--r--src/library/scala/annotation/migration.scala5
-rw-r--r--src/library/scala/collection/immutable/IntMap.scala2
-rw-r--r--src/library/scala/collection/immutable/LongMap.scala2
-rw-r--r--src/library/scala/collection/immutable/Range.scala16
-rw-r--r--src/library/scala/collection/mutable/AnyRefMap.scala451
-rw-r--r--src/library/scala/collection/mutable/LongMap.scala558
-rw-r--r--src/library/scala/concurrent/Future.scala2
-rw-r--r--src/library/scala/math/BigDecimal.scala3
-rw-r--r--src/library/scala/math/BigInt.scala3
-rw-r--r--src/library/scala/reflect/ClassManifestDeprecatedApis.scala23
-rw-r--r--src/library/scala/reflect/Manifest.scala12
-rw-r--r--src/library/scala/runtime/WorksheetSupport.scala93
-rw-r--r--src/library/scala/util/hashing/MurmurHash3.scala8
-rw-r--r--src/manual/scala/man1/scala.scala2
-rw-r--r--src/reflect/scala/reflect/api/JavaUniverse.scala2
-rw-r--r--src/reflect/scala/reflect/internal/Definitions.scala16
-rw-r--r--src/reflect/scala/reflect/internal/FreshNames.scala35
-rw-r--r--src/reflect/scala/reflect/internal/Mirrors.scala12
-rw-r--r--src/reflect/scala/reflect/internal/SymbolTable.scala6
-rw-r--r--src/reflect/scala/reflect/internal/Symbols.scala24
-rw-r--r--src/reflect/scala/reflect/internal/TreeInfo.scala2
-rw-r--r--src/reflect/scala/reflect/internal/util/FreshNameCreator.scala7
-rw-r--r--src/reflect/scala/reflect/runtime/JavaUniverseForce.scala1
-rw-r--r--src/repl/scala/tools/nsc/interpreter/IMain.scala3
-rw-r--r--src/repl/scala/tools/nsc/interpreter/JavapClass.scala2
-rw-r--r--src/scaladoc/scala/tools/ant/Scaladoc.scala6
-rw-r--r--src/scalap/scala/tools/scalap/Arguments.scala6
-rw-r--r--test/disabled/run/lisp.scala16
-rw-r--r--test/files/jvm/typerep.scala2
-rw-r--r--test/files/neg/class-of-double-targs.check4
-rw-r--r--test/files/neg/class-of-double-targs.scala3
-rw-r--r--test/files/neg/patmatexhaust.scala4
-rw-r--r--test/files/neg/t414.scala2
-rw-r--r--test/files/neg/t5702-neg-bad-and-wild.check2
-rw-r--r--test/files/neg/t5702-neg-bad-and-wild.scala2
-rw-r--r--test/files/neg/t7605-deprecation.check15
-rw-r--r--test/files/neg/t7605-deprecation.scala7
-rw-r--r--test/files/neg/t997.scala2
-rw-r--r--test/files/neg/wellkinded_wrongarity.check4
-rw-r--r--test/files/neg/wellkinded_wrongarity.scala2
-rw-r--r--test/files/pos/bounds.scala6
-rw-r--r--test/files/pos/patmat.scala4
-rw-r--r--test/files/pos/spec-doubledef-new.scala6
-rw-r--r--test/files/pos/spec-doubledef-old.scala6
-rw-r--r--test/files/pos/t0064.scala2
-rw-r--r--test/files/pos/t1014.scala16
-rw-r--r--test/files/pos/t1203a.scala13
-rw-r--r--test/files/pos/t247.scala4
-rw-r--r--test/files/pos/t2698.scala14
-rw-r--r--test/files/pos/t3160.scala6
-rw-r--r--test/files/pos/t443.scala8
-rw-r--r--test/files/pos/t4579.scala12
-rw-r--r--test/files/pos/t5120.scala4
-rw-r--r--test/files/pos/t6201.scala19
-rw-r--r--test/files/pos/t7987/Macro_1.scala6
-rw-r--r--test/files/pos/t7987/Test_2.scala12
-rw-r--r--test/files/pos/tcpoly_bounds1.scala4
-rw-r--r--test/files/pos/typealiases.scala2
-rw-r--r--test/files/pos/unapplyNeedsMemberType.scala2
-rw-r--r--test/files/pos/valdefs.scala2
-rw-r--r--test/files/positions/ExcludedPrefix1.scala2
-rw-r--r--test/files/positions/Overlap4.scala2
-rw-r--r--test/files/positions/Scaladoc7.scala2
-rw-r--r--test/files/presentation/callcc-interpreter.check8
-rw-r--r--test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala32
-rw-r--r--test/files/presentation/completion-implicit-chained.check2
-rw-r--r--test/files/presentation/ide-bug-1000349.check2
-rw-r--r--test/files/presentation/ide-bug-1000475.check6
-rw-r--r--test/files/presentation/ide-bug-1000531.check2
-rw-r--r--test/files/presentation/implicit-member.check2
-rw-r--r--test/files/presentation/ping-pong.check4
-rw-r--r--test/files/presentation/scope-completion-1.check19
-rw-r--r--test/files/presentation/scope-completion-1/Test.scala3
-rw-r--r--test/files/presentation/scope-completion-1/src/Completions.scala12
-rw-r--r--test/files/presentation/scope-completion-2.check35
-rw-r--r--test/files/presentation/scope-completion-2/Test.scala3
-rw-r--r--test/files/presentation/scope-completion-2/src/Completions.scala35
-rw-r--r--test/files/presentation/scope-completion-3.check111
-rw-r--r--test/files/presentation/scope-completion-3/Test.scala3
-rw-r--r--test/files/presentation/scope-completion-3/src/Completions.scala106
-rw-r--r--test/files/presentation/scope-completion-4.check293
-rw-r--r--test/files/presentation/scope-completion-4/Test.scala3
-rw-r--r--test/files/presentation/scope-completion-4/src/Completions.scala84
-rw-r--r--test/files/presentation/scope-completion-import.check141
-rw-r--r--test/files/presentation/scope-completion-import/Test.scala3
-rw-r--r--test/files/presentation/scope-completion-import/src/Completions.scala64
-rw-r--r--test/files/presentation/t1207.check12
-rw-r--r--test/files/presentation/t5708.check2
-rw-r--r--test/files/presentation/t7915.check11
-rw-r--r--test/files/presentation/t7915/Test.scala8
-rw-r--r--test/files/presentation/t7915/src/Foo.scala9
-rw-r--r--test/files/presentation/visibility.check10
-rw-r--r--test/files/run/Course-2002-05.scala16
-rw-r--r--test/files/run/Course-2002-06.scala2
-rw-r--r--test/files/run/Course-2002-07.scala140
-rw-r--r--test/files/run/Course-2002-08.scala28
-rw-r--r--test/files/run/Course-2002-09.scala40
-rw-r--r--test/files/run/Course-2002-13.scala16
-rw-r--r--test/files/run/bugs.scala2
-rw-r--r--test/files/run/ctries-old/main.scala2
-rw-r--r--test/files/run/fors.check28
-rw-r--r--test/files/run/fors.scala84
-rw-r--r--test/files/run/getClassTest-old.scala2
-rw-r--r--test/files/run/map_test.scala2
-rw-r--r--test/files/run/mutable-anyrefmap.scala91
-rw-r--r--test/files/run/mutable-longmap.scala79
-rw-r--r--test/files/run/patmatnew.scala28
-rw-r--r--test/files/run/repl-backticks.check2
-rw-r--r--test/files/run/repl-backticks.scala18
-rw-r--r--test/files/run/t1500.check3
-rw-r--r--test/files/run/t1500.scala46
-rw-r--r--test/files/run/t1501.check3
-rw-r--r--test/files/run/t1501.scala56
-rw-r--r--test/files/run/t3888.scala2
-rw-r--r--test/files/run/t4124.check4
-rw-r--r--test/files/run/t4124.scala24
-rw-r--r--test/files/run/t6329_repl_bug.check17
-rw-r--r--test/files/run/t6329_repl_bug.scala (renamed from test/files/run/t6329_repl_bug.pending)0
-rw-r--r--test/files/run/t6329_vanilla_bug.check3
-rw-r--r--test/files/run/t6329_vanilla_bug.scala (renamed from test/files/run/t6329_vanilla_bug.pending)0
-rw-r--r--test/files/run/tailcalls.scala2
-rw-r--r--test/files/run/tcpoly_parseridioms.check4
-rw-r--r--test/files/run/tcpoly_parseridioms.scala8
-rw-r--r--test/files/run/withIndex.scala2
-rw-r--r--test/files/scalacheck/CheckCollections.scala9
-rw-r--r--test/files/scalacheck/CheckEither.scala12
-rw-r--r--test/files/scalacheck/array-new.scala2
-rw-r--r--test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala6
-rw-r--r--test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala15
-rw-r--r--test/files/scalacheck/si4147.scala4
-rw-r--r--test/files/scalacheck/t2460.scala5
-rw-r--r--test/files/scalacheck/treeset.scala2
-rw-r--r--test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala47
-rw-r--r--test/pending/run/reify_callccinterpreter.scala12
-rw-r--r--test/pending/run/reify_simpleinterpreter.scala10
-rw-r--r--test/pending/shootout/fasta.scala64
-rw-r--r--test/pending/shootout/revcomp.scala-2.scala18
-rw-r--r--test/pending/shootout/revcomp.scala-3.scala40
189 files changed, 3271 insertions, 1270 deletions
diff --git a/docs/examples/fors.scala b/docs/examples/fors.scala
index b937e53fcd..29616b61b1 100644
--- a/docs/examples/fors.scala
+++ b/docs/examples/fors.scala
@@ -83,7 +83,7 @@ object fors {
if b1 != b2;
Elem(_, "author", _, _, Text(a1)) <- b1.toList;
Elem(_, "author", _, _, Text(a2)) <- b2.toList;
- if a1 == a2) yield Pair(a1, a2))
+ if a1 == a2) yield (a1, a2))
def removeDuplicates[a](xs: List[a]): List[a] =
if (xs.isEmpty)
diff --git a/docs/examples/iterators.scala b/docs/examples/iterators.scala
index e2e5e050a0..9ddb141d61 100644
--- a/docs/examples/iterators.scala
+++ b/docs/examples/iterators.scala
@@ -15,8 +15,8 @@ object iterators {
def findGreater(xs: Array[Double], limit: Double) =
xs.iterator
.zip(Iterator.from(0))
- .filter{case Pair(x, i) => x > limit }
- .map{case Pair(x, i) => i}
+ .filter{case (x, i) => x > limit }
+ .map{case (x, i) => i}
def main(args: Array[String]) {
val ar = Array/*[Double]*/(6, 2, 8, 5, 1)
diff --git a/docs/examples/jolib/Ref.scala b/docs/examples/jolib/Ref.scala
index 32952b4351..099a3c2df2 100644
--- a/docs/examples/jolib/Ref.scala
+++ b/docs/examples/jolib/Ref.scala
@@ -12,20 +12,20 @@ import concurrent.SyncVar;
import concurrent.jolib._;
class Ref[a](init: a) extends Join {
-
+
object get extends Synchr[a](this) { case class C() extends SyncVar[a]; }
object set extends Synchr[unit](this) { case class C(x: a) extends SyncVar[unit]; }
object state extends Asynchr(this) { case class C(x: a); }
rules (
- Pair(List(get, state), { case List(g @ get.C(), state.C(x) ) =>
+ (List(get, state), { case List(g @ get.C(), state.C(x) ) =>
{ g.set(x); state(state.C(x)) } }),
- Pair(List(set, state), { case List(s @ set.C(x), state.C(y) ) =>
+ (List(set, state), { case List(s @ set.C(x), state.C(y) ) =>
{ s.set(()); state(state.C(x)) } })
);
state(state.C(init));
-
+
def Get: a = get(get.C());
def Set(x: a): unit = set(set.C(x));
}
diff --git a/docs/examples/jolib/parallelOr.scala b/docs/examples/jolib/parallelOr.scala
index fb8288c5b2..a0305c56bf 100644
--- a/docs/examples/jolib/parallelOr.scala
+++ b/docs/examples/jolib/parallelOr.scala
@@ -13,27 +13,27 @@ import concurrent.SyncVar;
/** Implementation in the join-calculus of a parallel OR. */
object or extends Join {
-
+
object res extends Synchr[boolean](this) { case class C() extends SyncVar[boolean] };
object res1 extends Asynchr(this) { case class C(b: boolean); }
object res2 extends Asynchr(this) { case class C(b: boolean); }
object res1False extends Synchr[boolean](this) { case class C() extends SyncVar[boolean] };
object res2False extends Synchr[boolean](this) { case class C() extends SyncVar[boolean] };
-
+
rules(
- Pair(List(res, res1), { case List(r @ res.C(), res1.C(b)) =>
+ (List(res, res1), { case List(r @ res.C(), res1.C(b)) =>
if (b) r.set(b) else r.set(res1False(res1False.C())) }),
-
- Pair(List(res, res2), { case List(r @ res.C(), res2.C(b)) =>
+
+ (List(res, res2), { case List(r @ res.C(), res2.C(b)) =>
if (b) r.set(b) else r.set(res2False(res2False.C())) }),
-
- Pair(List(res1False, res2), { case List(r @ res1False.C(), res2.C(b)) =>
+
+ (List(res1False, res2), { case List(r @ res1False.C(), res2.C(b)) =>
r.set(b) }),
-
- Pair(List(res2False, res1), { case List(r @ res2False.C(), res1.C(b)) =>
+
+ (List(res2False, res1), { case List(r @ res2False.C(), res1.C(b)) =>
r.set(b) })
);
-
+
def apply(b1: => boolean, b2: => boolean): boolean = {
concurrent.ops.spawn(res1(res1.C(b1)));
concurrent.ops.spawn(res2(res2.C(b2)));
@@ -42,7 +42,7 @@ object or extends Join {
}
*/
object parallelOr {
-
+
def main(args: Array[String]): unit = {
def loop: boolean = { while (true) {}; true };
/*
diff --git a/docs/examples/monads/callccInterpreter.scala b/docs/examples/monads/callccInterpreter.scala
index 5b556bd8fa..b5008c4c1b 100644
--- a/docs/examples/monads/callccInterpreter.scala
+++ b/docs/examples/monads/callccInterpreter.scala
@@ -14,7 +14,7 @@ object callccInterpreter {
def showM(m: M[Value]): String = (m in id).toString();
- def callCC[A](h: (A => M[A]) => M[A]) =
+ def callCC[A](h: (A => M[A]) => M[A]) =
M[A](c => h(a => M[A](d => c(a))) in c);
type Name = String;
@@ -30,7 +30,7 @@ object callccInterpreter {
trait Value;
case object Wrong extends Value {
override def toString() = "wrong"
- }
+ }
case class Num(n: Int) extends Value {
override def toString() = n.toString();
}
@@ -38,15 +38,15 @@ object callccInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -62,15 +62,15 @@ object callccInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
- case Ccc(x, t) => callCC(k => interp(t, Pair(x, Fun(k)) :: e))
+ case Ccc(x, t) => callCC(k => interp(t, (x, Fun(k)) :: e))
}
- def test(t: Term): String =
+ def test(t: Term): String =
showM(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
diff --git a/docs/examples/monads/directInterpreter.scala b/docs/examples/monads/directInterpreter.scala
index 06fffba8e2..d8ca8ccfa7 100644
--- a/docs/examples/monads/directInterpreter.scala
+++ b/docs/examples/monads/directInterpreter.scala
@@ -20,15 +20,15 @@ object directInterpreter {
case Fun(f) => "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): Value = e match {
case List() => Wrong
- case Pair(y, b) :: e1 => if (x == y) b else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) b else lookup(x, e1)
}
- def add(a: Value, b: Value): Value = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => Num(m + n)
+ def add(a: Value, b: Value): Value = (a, b) match {
+ case (Num(m), Num(n)) => Num(m + n)
case _ => Wrong
}
@@ -41,15 +41,15 @@ object directInterpreter {
case Var(x) => lookup(x, e)
case Con(n) => Num(n)
case Add(l, r) => add(interp(l, e), interp(r, e))
- case Lam(x, t) => Fun(a => interp(t, Pair(x, a) :: e))
+ case Lam(x, t) => Fun(a => interp(t, (x, a) :: e))
case App(f, t) => apply(interp(f, e), interp(t, e))
}
- def test(t: Term): String =
+ def test(t: Term): String =
showval(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
- def main(args: Array[String]) =
+ def main(args: Array[String]) =
System.out.println(test(term0));
}
diff --git a/docs/examples/monads/errorInterpreter.scala b/docs/examples/monads/errorInterpreter.scala
index d3cc45627d..c15e1041e2 100644
--- a/docs/examples/monads/errorInterpreter.scala
+++ b/docs/examples/monads/errorInterpreter.scala
@@ -41,15 +41,15 @@ object errorInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]]
+ type Environment = List[Tuple2[Name, Value]]
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => errorM("unbound variable: " + x);
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => errorM("should be numbers: " + a + "," + b)
}
@@ -65,7 +65,7 @@ object errorInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
diff --git a/docs/examples/monads/simpleInterpreter.scala b/docs/examples/monads/simpleInterpreter.scala
index cde3a92dbb..64636749ff 100644
--- a/docs/examples/monads/simpleInterpreter.scala
+++ b/docs/examples/monads/simpleInterpreter.scala
@@ -22,7 +22,7 @@ object simpleInterpreter {
trait Value;
case object Wrong extends Value {
override def toString() = "wrong"
- }
+ }
case class Num(n: Int) extends Value {
override def toString() = n.toString();
}
@@ -30,15 +30,15 @@ object simpleInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -54,14 +54,14 @@ object simpleInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
}
- def test(t: Term): String =
+ def test(t: Term): String =
showM(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
diff --git a/docs/examples/monads/stateInterpreter.scala b/docs/examples/monads/stateInterpreter.scala
index 97f3335dab..e13e9049da 100644
--- a/docs/examples/monads/stateInterpreter.scala
+++ b/docs/examples/monads/stateInterpreter.scala
@@ -4,20 +4,20 @@ object stateInterpreter {
type State = Int;
- val tickS = new M(s => Pair((), s + 1));
+ val tickS = new M(s => ((), s + 1));
- case class M[A](in: State => Pair[A, State]) {
- def bind[B](k: A => M[B]) = M[B]{ s0 =>
- val Pair(a, s1) = this in s0; k(a) in s1
+ case class M[A](in: State => Tuple2[A, State]) {
+ def bind[B](k: A => M[B]) = M[B]{ s0 =>
+ val (a, s1) = this in s0; k(a) in s1
}
def map[B](f: A => B): M[B] = bind(x => unitM(f(x)));
def flatMap[B](f: A => M[B]): M[B] = bind(f);
}
- def unitM[A](a: A) = M[A](s => Pair(a, s));
+ def unitM[A](a: A) = M[A](s => (a, s));
def showM(m: M[Value]): String = {
- val Pair(a, s1) = m in 0;
+ val (a, s1) = m in 0;
"Value: " + a + "; Count: " + s1
}
@@ -41,15 +41,15 @@ object stateInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => for (_ <- tickS) yield Num(m + n)
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => for (_ <- tickS) yield Num(m + n)
case _ => unitM(Wrong)
}
@@ -65,14 +65,14 @@ object stateInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
}
- def test(t: Term): String =
+ def test(t: Term): String =
showM(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
diff --git a/docs/examples/patterns.scala b/docs/examples/patterns.scala
index 738deabc66..d082fcc3de 100644
--- a/docs/examples/patterns.scala
+++ b/docs/examples/patterns.scala
@@ -13,17 +13,17 @@ object patterns {
case Leaf(x) => x
}
- def find[a,b](it: Iterator[Pair[a, b]], x: a): Option[b] = {
+ def find[a,b](it: Iterator[Tuple2[a, b]], x: a): Option[b] = {
var result: Option[b] = None
var found = false
while (it.hasNext && !found) {
- val Pair(x1, y) = it.next
+ val (x1, y) = it.next
if (x == x1) { found = true; result = Some(y) }
}
result
}
- def printFinds[a](xs: List[Pair[a, String]], x: a) =
+ def printFinds[a](xs: List[Tuple2[a, String]], x: a) =
find(xs.iterator, x) match {
case Some(y) => System.out.println(y)
case None => System.out.println("no match")
@@ -31,6 +31,6 @@ object patterns {
def main(args: Array[String]) {
println("sum of leafs=" + sumLeaves(tree1))
- printFinds(List(Pair(3, "three"), Pair(4, "four")), 4)
+ printFinds(List((3, "three"), (4, "four")), 4)
}
}
diff --git a/docs/examples/pilib/elasticBuffer.scala b/docs/examples/pilib/elasticBuffer.scala
index 5fec96ab6c..c173735dbb 100644
--- a/docs/examples/pilib/elasticBuffer.scala
+++ b/docs/examples/pilib/elasticBuffer.scala
@@ -8,7 +8,7 @@ object elasticBuffer {
* Recursive type for channels that carry a "String" channel and
* an object of the type we define.
*/
- class MetaChan extends Chan[Pair[Chan[String], MetaChan]]
+ class MetaChan extends Chan[Tuple2[Chan[String], MetaChan]]
def Buffer(put: Chan[String], get: Chan[String]): Unit = {
@@ -18,19 +18,19 @@ object elasticBuffer {
def Bl(i:Chan[String], l: MetaChan,
o: Chan[String], r: MetaChan): unit =
choice (
- l(Pair(o,r)) * (System.out.println("Removed one cell.")),
+ l((o,r)) * (System.out.println("Removed one cell.")),
i * (inp => Cl(i, l, o, r, inp))
)
/**
* A buffer cell containing a value, ready to receive (o,r) from the right.
*/
- def Cl(i: Chan[String], l: MetaChan,
+ def Cl(i: Chan[String], l: MetaChan,
o: Chan[String], r: MetaChan, content: String): Unit =
choice (
o(content) * (Bl(i,l,o,r)),
i * (inp => Dl(i,l,o,r,content, inp)),
- r * ( { case Pair(newo, newr) => Cl(i,l,newo,newr,content) })
+ r * ( { case (newo, newr) => Cl(i,l,newo,newr,content) })
)
/**
diff --git a/docs/examples/pilib/handover.scala b/docs/examples/pilib/handover.scala
index c9b6156c2c..4e9a5670a0 100644
--- a/docs/examples/pilib/handover.scala
+++ b/docs/examples/pilib/handover.scala
@@ -13,14 +13,14 @@ object handoverRecursive {
* Recursive type for channels that carry a channel "unit" and
* an object of the type we define.
*/
- class Switch extends Chan[Pair[Chan[unit], Switch]]
+ class Switch extends Chan[Tuple2[Chan[unit], Switch]]
/**
* Car.
*/
def Car(talk: Chan[unit], switch: Switch): unit =
choice (
- switch * ({ case Pair(t,s) => Car(t, s) }),
+ switch * ({ case (t,s) => Car(t, s) }),
talk(()) * ( {
Thread.sleep(1 + random.nextInt(1000));
System.out.println("Car emitted a message.");
@@ -32,20 +32,20 @@ object handoverRecursive {
* Control center.
*/
def Control(talk1: Chan[unit], switch1: Switch,
- gain1: Switch, lose1: Switch,
+ gain1: Switch, lose1: Switch,
talk2: Chan[unit], switch2: Switch,
gain2: Switch, lose2: Switch): unit
= {
def Control1: unit= {
Thread.sleep(1 + random.nextInt(1000));
- lose1.write(Pair(talk2, switch2));
- gain2.write(Pair(talk2, switch2));
+ lose1.write((talk2, switch2));
+ gain2.write((talk2, switch2));
Control2
}
def Control2: unit = {
Thread.sleep(1 + random.nextInt(1000));
- lose2.write(Pair(talk1, switch1));
- gain1.write(Pair(talk1, switch1));
+ lose2.write((talk1, switch1));
+ gain1.write((talk1, switch1));
Control1
}
Control1
@@ -62,8 +62,8 @@ object handoverRecursive {
System.out.println(id + " received a message.")
ActiveTransmitter(id, talk, switch, gain, lose)
}),
- lose * ({ case Pair(t, s) => {
- switch.write(Pair(t, s))
+ lose * ({ case (t, s) => {
+ switch.write((t, s))
IdleTransmitter(id, gain, lose)
}})
);
@@ -72,7 +72,7 @@ object handoverRecursive {
* Idle transmitter.
*/
def IdleTransmitter(id: String, gain: Switch, lose: Switch): unit = {
- val Pair(t, s) = gain.read;
+ val (t, s) = gain.read;
ActiveTransmitter(id, t, s, gain, lose)
}
@@ -108,7 +108,7 @@ object handoverCast {
def Car(talk: Chan[Any], switch: Chan[Any]): unit =
choice (
switch * (o => {
- val Pair(t,s) = o.asInstanceOf[Pair[Chan[Any],Chan[Any]]];
+ val (t,s) = o.asInstanceOf[Tuple2[Chan[Any],Chan[Any]]];
Car(t, s)
}),
talk(()) * ( {
@@ -122,20 +122,20 @@ object handoverCast {
* Control center.
*/
def Control(talk1: Chan[Any], switch1: Chan[Any],
- gain1: Chan[Any], lose1: Chan[Any],
+ gain1: Chan[Any], lose1: Chan[Any],
talk2: Chan[Any], switch2: Chan[Any],
gain2: Chan[Any], lose2: Chan[Any]): unit
= {
def Control1: unit = {
Thread.sleep(1 + random.nextInt(1000));
- lose1.write(Pair(talk2, switch2));
- gain2.write(Pair(talk2, switch2));
+ lose1.write((talk2, switch2));
+ gain2.write((talk2, switch2));
Control2
}
def Control2: unit = {
Thread.sleep(1 + random.nextInt(1000));
- lose2.write(Pair(talk1, switch1));
- gain1.write(Pair(talk1, switch1));
+ lose2.write((talk1, switch1));
+ gain1.write((talk1, switch1));
Control1
}
Control1
@@ -153,8 +153,8 @@ object handoverCast {
ActiveTransmitter(id, talk, switch, gain, lose)
}),
lose * (o => {
- val Pair(t, s) = o.asInstanceOf[Pair[Chan[Any],Chan[Any]]]
- switch.write(Pair(t, s))
+ val (t, s) = o.asInstanceOf[Tuple2[Chan[Any],Chan[Any]]]
+ switch.write((t, s))
IdleTransmitter(id, gain, lose)
})
)
@@ -163,7 +163,7 @@ object handoverCast {
* Idle transmitter.
*/
def IdleTransmitter(id: String, gain: Chan[Any], lose: Chan[Any]): unit = {
- val Pair(t, s) = gain.read.asInstanceOf[Pair[Chan[Any],Chan[Any]]]
+ val (t, s) = gain.read.asInstanceOf[Tuple2[Chan[Any],Chan[Any]]]
ActiveTransmitter(id, t, s, gain, lose)
}
diff --git a/docs/examples/pilib/piNat.scala b/docs/examples/pilib/piNat.scala
index a1a0e682e1..c6d9bdaf5c 100644
--- a/docs/examples/pilib/piNat.scala
+++ b/docs/examples/pilib/piNat.scala
@@ -4,23 +4,23 @@ import scala.concurrent.pilib._
/** Church encoding of naturals in the Pi-calculus */
object piNat extends Application {
-
+
/** Locations of Pi-calculus natural */
- class NatChan extends Chan[Triple[Chan[Unit], Chan[NatChan], Chan[NatChan]]]
+ class NatChan extends Chan[Tuple3[Chan[Unit], Chan[NatChan], Chan[NatChan]]]
/** Zero */
def Z(l: NatChan): Unit = choice (
- l * { case Triple(z, sd, d) => z.write(()) }
+ l * { case (z, sd, d) => z.write(()) }
)
/** Successor of Double */
def SD(n: NatChan, l: NatChan): Unit = choice (
- l * { case Triple(z, sd, d) => sd.write(n) }
+ l * { case (z, sd, d) => sd.write(n) }
)
/** Double */
def D(n: NatChan, l: NatChan): Unit = choice (
- l * { case Triple(z, sd, d) => d.write(n) }
+ l * { case (z, sd, d) => d.write(n) }
)
/** Make "l" a location representing the natural "n" */
@@ -34,7 +34,7 @@ object piNat extends Application {
val z = new Chan[Unit]
val sd = new Chan[NatChan]
val d = new Chan[NatChan]
- spawn < m.write(Triple(z, sd, d)) >;
+ spawn < m.write((z, sd, d)) >;
choice (
z * { x => make(1, n) },
sd * { m1 => { val n1 = new NatChan; spawn < D(n1, n) >; Succ(m1, n1) } },
@@ -47,7 +47,7 @@ object piNat extends Application {
val z = new Chan[Unit]
val sd = new Chan[NatChan]
val d = new Chan[NatChan]
- spawn < l.write(Triple(z, sd, d)) >;
+ spawn < l.write((z, sd, d)) >;
choice (
z * { x => spawn < Z(m) >; Z(n) },
sd * { l1 => { val m1 = new NatChan; val n1 = new NatChan;
@@ -64,7 +64,7 @@ object piNat extends Application {
val z = new Chan[Unit]
val sd = new Chan[NatChan]
val d = new Chan[NatChan]
- spawn < n.write(Triple(z, sd, d)) >;
+ spawn < n.write((z, sd, d)) >;
choice (
z * { x => 0 },
sd * { n1 => 2 * value(n1) + 1 },
diff --git a/docs/examples/typeinf.scala b/docs/examples/typeinf.scala
index d4bc8bf3e1..ac6cc35f6b 100644
--- a/docs/examples/typeinf.scala
+++ b/docs/examples/typeinf.scala
@@ -53,11 +53,11 @@ object typeInfer {
(emptySubst /: tyvars) ((s, tv) => s.extend(tv, newTyvar())) (tpe)
}
- type Env = List[Pair[String, TypeScheme]]
+ type Env = List[Tuple2[String, TypeScheme]]
def lookup(env: Env, x: String): TypeScheme = env match {
case List() => null
- case Pair(y, t) :: env1 => if (x == y) t else lookup(env1, x)
+ case (y, t) :: env1 => if (x == y) t else lookup(env1, x)
}
def gen(env: Env, t: Type): TypeScheme =
@@ -69,22 +69,22 @@ object typeInfer {
case Tycon(k, ts) => (List[Tyvar]() /: ts) ((tvs, t) => tvs union tyvars(t))
}
- def tyvars(ts: TypeScheme): List[Tyvar] =
+ def tyvars(ts: TypeScheme): List[Tyvar] =
tyvars(ts.tpe) diff ts.tyvars;
def tyvars(env: Env): List[Tyvar] =
(List[Tyvar]() /: env) ((tvs, nt) => tvs union tyvars(nt._2))
- def mgu(t: Type, u: Type, s: Subst): Subst = Pair(s(t), s(u)) match {
- case Pair(Tyvar(a), Tyvar(b)) if (a == b) =>
+ def mgu(t: Type, u: Type, s: Subst): Subst = (s(t), s(u)) match {
+ case (Tyvar(a), Tyvar(b)) if (a == b) =>
s
- case Pair(Tyvar(a), _) if !(tyvars(u) contains a) =>
+ case (Tyvar(a), _) if !(tyvars(u) contains a) =>
s.extend(Tyvar(a), u)
- case Pair(_, Tyvar(a)) =>
+ case (_, Tyvar(a)) =>
mgu(u, t, s)
- case Pair(Arrow(t1, t2), Arrow(u1, u2)) =>
+ case (Arrow(t1, t2), Arrow(u1, u2)) =>
mgu(t1, u1, mgu(t2, u2, s))
- case Pair(Tycon(k1, ts), Tycon(k2, us)) if (k1 == k2) =>
+ case (Tycon(k1, ts), Tycon(k2, us)) if (k1 == k2) =>
(s /: (ts zip us)) ((s, tu) => mgu(tu._1, tu._2, s))
case _ =>
throw new TypeError("cannot unify " + s(t) + " with " + s(u))
@@ -103,7 +103,7 @@ object typeInfer {
case Lam(x, e1) =>
val a, b = newTyvar()
val s1 = mgu(t, Arrow(a, b), s)
- val env1 = Pair(x, TypeScheme(List(), a)) :: env
+ val env1 = (x, TypeScheme(List(), a)) :: env
tp(env1, e1, b, s1)
case App(e1, e2) =>
@@ -114,7 +114,7 @@ object typeInfer {
case Let(x, e1, e2) =>
val a = newTyvar()
val s1 = tp(env, e1, a, s)
- tp(Pair(x, gen(env, s1(a))) :: env, e2, t, s1)
+ tp((x, gen(env, s1(a))) :: env, e2, t, s1)
}
}
var current: Term = null
@@ -134,18 +134,18 @@ object typeInfer {
private val a = typeInfer.newTyvar()
val env = List(
/*
- Pair("true", gen(booleanType)),
- Pair("false", gen(booleanType)),
- Pair("if", gen(Arrow(booleanType, Arrow(a, Arrow(a, a))))),
- Pair("zero", gen(intType)),
- Pair("succ", gen(Arrow(intType, intType))),
- Pair("nil", gen(listType(a))),
- Pair("cons", gen(Arrow(a, Arrow(listType(a), listType(a))))),
- Pair("isEmpty", gen(Arrow(listType(a), booleanType))),
- Pair("head", gen(Arrow(listType(a), a))),
- Pair("tail", gen(Arrow(listType(a), listType(a)))),
+ ("true", gen(booleanType)),
+ ("false", gen(booleanType)),
+ ("if", gen(Arrow(booleanType, Arrow(a, Arrow(a, a))))),
+ ("zero", gen(intType)),
+ ("succ", gen(Arrow(intType, intType))),
+ ("nil", gen(listType(a))),
+ ("cons", gen(Arrow(a, Arrow(listType(a), listType(a))))),
+ ("isEmpty", gen(Arrow(listType(a), booleanType))),
+ ("head", gen(Arrow(listType(a), a))),
+ ("tail", gen(Arrow(listType(a), listType(a)))),
*/
- Pair("fix", gen(Arrow(Arrow(a, a), a)))
+ ("fix", gen(Arrow(Arrow(a, a), a)))
)
}
@@ -181,7 +181,7 @@ object typeInfer {
yield Lam(x, t): Term )
|||
( for (
- letid <- id if letid == "let";
+ letid <- id if letid == "let";
x <- ident;
_ <- wschr('=');
t <- term;
@@ -220,7 +220,7 @@ object typeInfer {
val input = 0
def any = new Parser[char] {
def apply(in: int): Parser[char]#Result =
- if (in < s.length()) Some(Pair(s charAt in, in + 1)) else None
+ if (in < s.length()) Some((s charAt in, in + 1)) else None
}
}
@@ -239,7 +239,7 @@ object typeInfer {
if (args.length == 1) {
val ps = new ParseString(args(0)) with MiniMLParsers
ps.all(ps.input) match {
- case Some(Pair(term, _)) =>
+ case Some((term, _)) =>
"" + term + ": " + showType(term)
case None =>
"syntax error"
diff --git a/src/actors/scala/actors/Future.scala b/src/actors/scala/actors/Future.scala
index 9d123cb2d5..4421c7a07a 100644
--- a/src/actors/scala/actors/Future.scala
+++ b/src/actors/scala/actors/Future.scala
@@ -180,17 +180,17 @@ object Futures {
var cnt = 0
val mappedFts = fts.map(ft =>
- Pair({cnt+=1; cnt-1}, ft))
+ ({cnt+=1; cnt-1}, ft))
- val unsetFts = mappedFts.filter((p: Pair[Int, Future[Any]]) => {
+ val unsetFts = mappedFts.filter((p: Tuple2[Int, Future[Any]]) => {
if (p._2.isSet) { resultsMap(p._1) = Some(p._2()); false }
else { resultsMap(p._1) = None; true }
})
- val partFuns = unsetFts.map((p: Pair[Int, Future[Any]]) => {
+ val partFuns = unsetFts.map((p: Tuple2[Int, Future[Any]]) => {
val FutCh = p._2.inputChannel
- val singleCase: PartialFunction[Any, Pair[Int, Any]] = {
- case FutCh ! any => Pair(p._1, any)
+ val singleCase: PartialFunction[Any, Tuple2[Int, Any]] = {
+ case FutCh ! any => (p._1, any)
}
singleCase
})
@@ -201,7 +201,7 @@ object Futures {
}
Actor.timer.schedule(timerTask, timeout)
- def awaitWith(partFuns: Seq[PartialFunction[Any, Pair[Int, Any]]]) {
+ def awaitWith(partFuns: Seq[PartialFunction[Any, Tuple2[Int, Any]]]) {
val reaction: PartialFunction[Any, Unit] = new PartialFunction[Any, Unit] {
def isDefinedAt(msg: Any) = msg match {
case TIMEOUT => true
@@ -212,7 +212,7 @@ object Futures {
case _ => {
val pfOpt = partFuns find (_ isDefinedAt msg)
val pf = pfOpt.get // succeeds always
- val Pair(idx, subres) = pf(msg)
+ val (idx, subres) = pf(msg)
resultsMap(idx) = Some(subres)
val partFunsRest = partFuns filter (_ != pf)
diff --git a/src/actors/scala/actors/remote/NetKernel.scala b/src/actors/scala/actors/remote/NetKernel.scala
index 4795ff3eb6..57d7af6d26 100644
--- a/src/actors/scala/actors/remote/NetKernel.scala
+++ b/src/actors/scala/actors/remote/NetKernel.scala
@@ -43,8 +43,8 @@ private[remote] class NetKernel(service: Service) {
private val names = new mutable.HashMap[OutputChannel[Any], Symbol]
def register(name: Symbol, a: OutputChannel[Any]): Unit = synchronized {
- actors += Pair(name, a)
- names += Pair(a, name)
+ actors(name) = a
+ names(a) = name
}
def getOrCreateName(from: OutputChannel[Any]) = names.get(from) match {
@@ -79,7 +79,7 @@ private[remote] class NetKernel(service: Service) {
def createProxy(node: Node, sym: Symbol): Proxy = {
val p = new Proxy(node, sym, this)
- proxies += Pair((node, sym), p)
+ proxies((node, sym)) = p
p
}
@@ -99,7 +99,7 @@ private[remote] class NetKernel(service: Service) {
proxies.synchronized {
proxies.get((senderNode, senderName)) match {
case Some(senderProxy) => // do nothing
- case None => proxies += Pair((senderNode, senderName), p)
+ case None => proxies((senderNode, senderName)) = p
}
}
diff --git a/src/actors/scala/actors/remote/Proxy.scala b/src/actors/scala/actors/remote/Proxy.scala
index 43a43ac99c..9949b36181 100644
--- a/src/actors/scala/actors/remote/Proxy.scala
+++ b/src/actors/scala/actors/remote/Proxy.scala
@@ -142,7 +142,7 @@ private[remote] class DelegateActor(creator: Proxy, node: Node, name: Symbol, ke
// create a new reply channel...
val replyCh = new Channel[Any](this)
// ...that maps to session
- sessionMap += Pair(replyCh, session)
+ sessionMap(replyCh) = session
// local send
out.send(msg, replyCh)
@@ -178,7 +178,7 @@ private[remote] class DelegateActor(creator: Proxy, node: Node, name: Symbol, ke
// create fresh session ID...
val fresh = FreshNameCreator.newName(node+"@"+name)
// ...that maps to reply channel
- channelMap += Pair(fresh, sender)
+ channelMap(fresh) = sender
kernel.forward(sender, node, name, msg, fresh)
} else {
kernel.forward(sender, node, name, msg, 'nosession)
diff --git a/src/actors/scala/actors/remote/RemoteActor.scala b/src/actors/scala/actors/remote/RemoteActor.scala
index 799076a01f..2daf9ceb43 100644
--- a/src/actors/scala/actors/remote/RemoteActor.scala
+++ b/src/actors/scala/actors/remote/RemoteActor.scala
@@ -64,7 +64,7 @@ object RemoteActor {
val serv = TcpService(port, cl)
val kern = serv.kernel
val s = Actor.self(Scheduler)
- kernels += Pair(s, kern)
+ kernels(s) = kern
s.onTerminate {
Debug.info("alive actor "+s+" terminated")
@@ -90,7 +90,7 @@ object RemoteActor {
val kernel = kernels.get(Actor.self(Scheduler)) match {
case None =>
val serv = TcpService(TcpService.generatePort, cl)
- kernels += Pair(Actor.self(Scheduler), serv.kernel)
+ kernels(Actor.self(Scheduler)) = serv.kernel
serv.kernel
case Some(k) =>
k
diff --git a/src/actors/scala/actors/remote/TcpService.scala b/src/actors/scala/actors/remote/TcpService.scala
index 75e36b2738..69e5c46c52 100644
--- a/src/actors/scala/actors/remote/TcpService.scala
+++ b/src/actors/scala/actors/remote/TcpService.scala
@@ -35,7 +35,7 @@ object TcpService {
service
case None =>
val service = new TcpService(port, cl)
- ports += Pair(port, service)
+ ports(port) = service
service.start()
Debug.info("created service at "+service.node)
service
@@ -106,9 +106,9 @@ class TcpService(port: Int, cl: ClassLoader) extends Thread with Service {
// when remote net kernel comes up
(pendingSends.get(node): @unchecked) match {
case None =>
- pendingSends += Pair(node, List(data))
+ pendingSends(node) = List(data)
case Some(msgs) if msgs.length < TcpService.BufSize =>
- pendingSends += Pair(node, data :: msgs)
+ pendingSends(node) = data :: msgs
}
}
@@ -183,7 +183,7 @@ class TcpService(port: Int, cl: ClassLoader) extends Thread with Service {
new mutable.HashMap[Node, TcpServiceWorker]
private[actors] def addConnection(node: Node, worker: TcpServiceWorker) = synchronized {
- connections += Pair(node, worker)
+ connections(node) = worker
}
def getConnection(n: Node) = synchronized {
diff --git a/src/compiler/scala/reflect/macros/compiler/Resolvers.scala b/src/compiler/scala/reflect/macros/compiler/Resolvers.scala
index 03d306f593..e4851632a5 100644
--- a/src/compiler/scala/reflect/macros/compiler/Resolvers.scala
+++ b/src/compiler/scala/reflect/macros/compiler/Resolvers.scala
@@ -9,7 +9,7 @@ trait Resolvers {
import global._
import analyzer._
- import definitions.{EmptyPackageClass => _, _}
+ import definitions._
import treeInfo._
import gen._
private val runDefinitions = currentRun.runDefinitions
diff --git a/src/compiler/scala/tools/ant/ScalaTool.scala b/src/compiler/scala/tools/ant/ScalaTool.scala
index e7ac53c8fb..bb6a933d3f 100644
--- a/src/compiler/scala/tools/ant/ScalaTool.scala
+++ b/src/compiler/scala/tools/ant/ScalaTool.scala
@@ -139,7 +139,7 @@ class ScalaTool extends ScalaMatchingTask {
val st = s.trim
val stArray = st.split("=", 2)
if (stArray.length == 2) {
- if (input != "") List(Pair(stArray(0), stArray(1))) else Nil
+ if (input != "") List((stArray(0), stArray(1))) else Nil
}
else
buildError("Property " + st + " is not formatted properly.")
@@ -170,7 +170,7 @@ class ScalaTool extends ScalaMatchingTask {
private def getProperties: String =
properties.map({
- case Pair(name,value) => "-D" + name + "=\"" + value + "\""
+ case (name,value) => "-D" + name + "=\"" + value + "\""
}).mkString("", " ", "")
/*============================================================================*\
diff --git a/src/compiler/scala/tools/ant/sabbus/Compilers.scala b/src/compiler/scala/tools/ant/sabbus/Compilers.scala
index b1994233e8..a0aad49f20 100644
--- a/src/compiler/scala/tools/ant/sabbus/Compilers.scala
+++ b/src/compiler/scala/tools/ant/sabbus/Compilers.scala
@@ -27,7 +27,7 @@ object Compilers extends scala.collection.DefaultMap[String, Compiler] {
if (debug) println("Making compiler " + id)
if (debug) println(" memory before: " + freeMemoryString)
val comp = new Compiler(classpath, settings)
- container += Pair(id, comp)
+ container(id) = comp
if (debug) println(" memory after: " + freeMemoryString)
comp
}
diff --git a/src/compiler/scala/tools/nsc/ast/parser/Parsers.scala b/src/compiler/scala/tools/nsc/ast/parser/Parsers.scala
index cd1869340a..ef4052d5f3 100644
--- a/src/compiler/scala/tools/nsc/ast/parser/Parsers.scala
+++ b/src/compiler/scala/tools/nsc/ast/parser/Parsers.scala
@@ -2530,11 +2530,7 @@ self =>
val vparamss = paramClauses(nme.CONSTRUCTOR, classContextBounds map (_.duplicate), ofCaseClass = false)
newLineOptWhenFollowedBy(LBRACE)
val rhs = in.token match {
- case LBRACE => {
- if (settings.future)
- deprecationWarning(in.offset, "Procedure syntax is deprecated. Convert procedure to method by adding `: Unit =`.")
- atPos(in.offset) { constrBlock(vparamss) }
- }
+ case LBRACE => atPos(in.offset) { constrBlock(vparamss) }
case _ => accept(EQUALS) ; atPos(in.offset) { constrExpr(vparamss) }
}
DefDef(mods, nme.CONSTRUCTOR, List(), vparamss, TypeTree(), rhs)
@@ -2560,14 +2556,16 @@ self =>
var restype = fromWithinReturnType(typedOpt())
val rhs =
if (isStatSep || in.token == RBRACE) {
- if (settings.future)
- deprecationWarning(in.lastOffset, "Procedure syntax is deprecated. Convert procedure to method by adding `: Unit`.")
- if (restype.isEmpty) restype = scalaUnitConstr
+ if (restype.isEmpty) {
+ if (settings.future)
+ deprecationWarning(in.lastOffset, s"Procedure syntax is deprecated. Convert procedure `$name` to method by adding `: Unit`.")
+ restype = scalaUnitConstr
+ }
newmods |= Flags.DEFERRED
EmptyTree
} else if (restype.isEmpty && in.token == LBRACE) {
if (settings.future)
- deprecationWarning(in.offset, "Procedure syntax is deprecated. Convert procedure to method by adding `: Unit =`.")
+ deprecationWarning(in.offset, s"Procedure syntax is deprecated. Convert procedure `$name` to method by adding `: Unit =`.")
restype = scalaUnitConstr
blockExpr()
} else {
diff --git a/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala b/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala
index 60f7857d0c..939641c3eb 100644
--- a/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala
+++ b/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala
@@ -69,7 +69,7 @@ abstract class Liveness {
case STORE_LOCAL(local) if (!genSet(local)) => killSet = killSet + local
case _ => ()
}
- Pair(genSet, killSet)
+ (genSet, killSet)
}
override def run() {
diff --git a/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala b/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala
index 7a53293384..f10d7cdc40 100644
--- a/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala
+++ b/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala
@@ -418,7 +418,7 @@ abstract class TypeFlowAnalysis {
!blackballed(concreteMethod)
}
if(isCandidate) {
- remainingCALLs += Pair(cm, CallsiteInfo(b, receiver, result.stack.length, concreteMethod))
+ remainingCALLs(cm) = CallsiteInfo(b, receiver, result.stack.length, concreteMethod)
} else {
remainingCALLs.remove(cm)
isOnWatchlist.remove(cm)
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala
index c166b0bb7e..4f9f4c9e31 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala
@@ -741,13 +741,13 @@ abstract class BCodeBodyBuilder extends BCodeSkelBuilder {
var flatKeys: List[Int] = Nil
var targets: List[asm.Label] = Nil
var default: asm.Label = null
- var switchBlocks: List[Pair[asm.Label, Tree]] = Nil
+ var switchBlocks: List[Tuple2[asm.Label, Tree]] = Nil
// collect switch blocks and their keys, but don't emit yet any switch-block.
for (caze @ CaseDef(pat, guard, body) <- tree.cases) {
assert(guard == EmptyTree, guard)
val switchBlockPoint = new asm.Label
- switchBlocks ::= Pair(switchBlockPoint, body)
+ switchBlocks ::= (switchBlockPoint, body)
pat match {
case Literal(value) =>
flatKeys ::= value.intValue
@@ -772,7 +772,7 @@ abstract class BCodeBodyBuilder extends BCodeSkelBuilder {
// emit switch-blocks.
val postMatch = new asm.Label
for (sb <- switchBlocks.reverse) {
- val Pair(caseLabel, caseBody) = sb
+ val (caseLabel, caseBody) = sb
markProgramPoint(caseLabel)
genLoad(caseBody, generatedType)
bc goTo postMatch
@@ -790,7 +790,7 @@ abstract class BCodeBodyBuilder extends BCodeSkelBuilder {
genLoad(expr, expectedType)
val end = currProgramPoint()
if (emitVars) { // add entries to LocalVariableTable JVM attribute
- for (Pair(sym, start) <- varsInScope.reverse) { emitLocalVarScope(sym, start, end) }
+ for ((sym, start) <- varsInScope.reverse) { emitLocalVarScope(sym, start, end) }
}
varsInScope = savedScope
}
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala
index c22ced26a5..64ed094a47 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala
@@ -112,7 +112,7 @@ abstract class BCodeHelpers extends BCodeTypes with BytecodeWriters {
val ta = exemplars.get(a)
val tb = exemplars.get(b)
- val res = Pair(ta.isInterface, tb.isInterface) match {
+ val res = (ta.isInterface, tb.isInterface) match {
case (true, true) =>
// exercised by test/files/run/t4761.scala
if (tb.isSubtypeOf(ta.c)) ta.c
@@ -759,7 +759,7 @@ abstract class BCodeHelpers extends BCodeTypes with BytecodeWriters {
def emitParamAnnotations(jmethod: asm.MethodVisitor, pannotss: List[List[AnnotationInfo]]) {
val annotationss = pannotss map (_ filter shouldEmitAnnotation)
if (annotationss forall (_.isEmpty)) return
- for (Pair(annots, idx) <- annotationss.zipWithIndex;
+ for ((annots, idx) <- annotationss.zipWithIndex;
annot <- annots) {
val AnnotationInfo(typ, args, assocs) = annot
assert(args.isEmpty, args)
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala
index 5fe03624cf..c921d11d00 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala
@@ -436,7 +436,7 @@ abstract class BCodeSkelBuilder extends BCodeHelpers {
var labelDef: scala.collection.Map[Symbol, LabelDef] = null// (LabelDef-sym -> LabelDef)
// bookkeeping the scopes of non-synthetic local vars, to emit debug info (`emitVars`).
- var varsInScope: List[Pair[Symbol, asm.Label]] = null // (local-var-sym -> start-of-scope)
+ var varsInScope: List[Tuple2[Symbol, asm.Label]] = null // (local-var-sym -> start-of-scope)
// helpers around program-points.
def lastInsn: asm.tree.AbstractInsnNode = {
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala
index 916d118b6e..5be5abd895 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala
@@ -90,11 +90,11 @@ abstract class BCodeTypes extends BCodeIdiomatic {
)
boxResultType =
- for(Pair(csym, msym) <- currentRun.runDefinitions.boxMethod)
+ for((csym, msym) <- currentRun.runDefinitions.boxMethod)
yield (msym -> classLiteral(primitiveTypeMap(csym)))
unboxResultType =
- for(Pair(csym, msym) <- currentRun.runDefinitions.unboxMethod)
+ for((csym, msym) <- currentRun.runDefinitions.unboxMethod)
yield (msym -> primitiveTypeMap(csym))
// boxed classes are looked up in the `exemplars` map by jvmWiseLUB().
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala b/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala
index 5e885fdd04..e92f8c2541 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala
@@ -293,7 +293,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
def inameToSymbol(iname: String): Symbol = {
val name = global.newTypeName(iname)
val res0 =
- if (nme.isModuleName(name)) rootMirror.getModule(name.dropModule)
+ if (nme.isModuleName(name)) rootMirror.getModuleByName(name.dropModule)
else rootMirror.getClassByName(name.replace('/', '.')) // TODO fails for inner classes (but this hasn't been tested).
assert(res0 != NoSymbol)
val res = jsymbol(res0)
@@ -335,7 +335,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
assert(a.isClass)
assert(b.isClass)
- val res = Pair(a.isInterface, b.isInterface) match {
+ val res = (a.isInterface, b.isInterface) match {
case (true, true) =>
global.lub(List(a.tpe, b.tpe)).typeSymbol // TODO assert == firstCommonSuffix of resp. parents
case (true, false) =>
@@ -1014,7 +1014,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
def emitParamAnnotations(jmethod: asm.MethodVisitor, pannotss: List[List[AnnotationInfo]]) {
val annotationss = pannotss map (_ filter shouldEmitAnnotation)
if (annotationss forall (_.isEmpty)) return
- for (Pair(annots, idx) <- annotationss.zipWithIndex;
+ for ((annots, idx) <- annotationss.zipWithIndex;
annot <- annots) {
val AnnotationInfo(typ, args, assocs) = annot
assert(args.isEmpty, args)
@@ -2156,7 +2156,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
def getMerged(): scala.collection.Map[Local, List[Interval]] = {
// TODO should but isn't: unbalanced start(s) of scope(s)
- val shouldBeEmpty = pending filter { p => val Pair(_, st) = p; st.nonEmpty }
+ val shouldBeEmpty = pending filter { p => val (_, st) = p; st.nonEmpty }
val merged = mutable.Map[Local, List[Interval]]()
def addToMerged(lv: Local, start: Label, end: Label) {
val intv = Interval(start, end)
@@ -2169,7 +2169,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
(b) take the latest end (onePastLast if none available)
(c) merge the thus made-up interval
*/
- for(Pair(k, st) <- shouldBeEmpty) {
+ for((k, st) <- shouldBeEmpty) {
var start = st.toList.sortBy(_.getOffset).head
if(merged.isDefinedAt(k)) {
val balancedStart = merged(k).head.lstart
@@ -2206,25 +2206,25 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
}
// adding non-param locals
var anonCounter = 0
- var fltnd: List[Triple[String, Local, Interval]] = Nil
- for(Pair(local, ranges) <- scoping.getMerged()) {
+ var fltnd: List[Tuple3[String, Local, Interval]] = Nil
+ for((local, ranges) <- scoping.getMerged()) {
var name = javaName(local.sym)
if (name == null) {
anonCounter += 1
name = "<anon" + anonCounter + ">"
}
for(intrvl <- ranges) {
- fltnd ::= Triple(name, local, intrvl)
+ fltnd ::= (name, local, intrvl)
}
}
// quest for deterministic output that Map.toList doesn't provide (so that ant test.stability doesn't complain).
val srtd = fltnd.sortBy { kr =>
- val Triple(name: String, _, intrvl: Interval) = kr
+ val (name: String, _, intrvl: Interval) = kr
- Triple(intrvl.start, intrvl.end - intrvl.start, name) // ie sort by (start, length, name)
+ (intrvl.start, intrvl.end - intrvl.start, name) // ie sort by (start, length, name)
}
- for(Triple(name, local, Interval(start, end)) <- srtd) {
+ for((name, local, Interval(start, end)) <- srtd) {
jmethod.visitLocalVariable(name, descriptor(local.kind), null, start, end, indexOf(local))
}
// "There may be no more than one LocalVariableTable attribute per local variable in the Code attribute"
diff --git a/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala b/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala
index 0cfcea87f8..0f317422ac 100644
--- a/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala
+++ b/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala
@@ -119,7 +119,7 @@ abstract class DeadCodeElimination extends SubComponent {
m foreachBlock { bb =>
useful(bb) = new mutable.BitSet(bb.size)
var rd = rdef.in(bb)
- for (Pair(i, idx) <- bb.toList.zipWithIndex) {
+ for ((i, idx) <- bb.toList.zipWithIndex) {
// utility for adding to worklist
def moveToWorkList() = moveToWorkListIf(cond = true)
@@ -137,7 +137,7 @@ abstract class DeadCodeElimination extends SubComponent {
i match {
case LOAD_LOCAL(_) =>
- defs = defs + Pair(((bb, idx)), rd.vars)
+ defs = defs + (((bb, idx), rd.vars))
moveToWorkListIf(cond = false)
case STORE_LOCAL(l) =>
@@ -350,7 +350,7 @@ abstract class DeadCodeElimination extends SubComponent {
val oldInstr = bb.toList
bb.open()
bb.clear()
- for (Pair(i, idx) <- oldInstr.zipWithIndex) {
+ for ((i, idx) <- oldInstr.zipWithIndex) {
if (useful(bb)(idx)) {
debuglog(" * " + i + " is useful")
bb.emit(i, i.pos)
diff --git a/src/compiler/scala/tools/nsc/plugins/Plugin.scala b/src/compiler/scala/tools/nsc/plugins/Plugin.scala
index 1578caff26..d194c095f8 100644
--- a/src/compiler/scala/tools/nsc/plugins/Plugin.scala
+++ b/src/compiler/scala/tools/nsc/plugins/Plugin.scala
@@ -144,7 +144,7 @@ object Plugin {
// (j, Try(descriptor))
def required(j: Path) = j -> loadDescriptionFromJar(j)
- type Paired = Pair[Path, Try[PluginDescription]]
+ type Paired = Tuple2[Path, Try[PluginDescription]]
val included: List[Paired] = (dirs flatMap (_ ifDirectory scan)).flatten
val exploded: List[Paired] = jars flatMap (_ ifDirectory explode)
val explicit: List[Paired] = jars flatMap (_ ifFile required)
diff --git a/src/compiler/scala/tools/nsc/reporters/Reporter.scala b/src/compiler/scala/tools/nsc/reporters/Reporter.scala
index 0544da5d3c..68362c066d 100644
--- a/src/compiler/scala/tools/nsc/reporters/Reporter.scala
+++ b/src/compiler/scala/tools/nsc/reporters/Reporter.scala
@@ -80,10 +80,4 @@ abstract class Reporter {
WARNING.count = 0
cancelled = false
}
-
- // sbt compat
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- def countElementsAsString(n: Int, elements: String): String = StringOps.countElementsAsString(n, elements)
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- def countAsString(n: Int): String = StringOps.countAsString(n)
}
diff --git a/src/compiler/scala/tools/nsc/scratchpad/Mixer.scala b/src/compiler/scala/tools/nsc/scratchpad/Mixer.scala
deleted file mode 100644
index 3aecc06b1e..0000000000
--- a/src/compiler/scala/tools/nsc/scratchpad/Mixer.scala
+++ /dev/null
@@ -1,99 +0,0 @@
-package scala.tools.nsc.scratchpad
-
-import java.io.{FileInputStream, InputStreamReader, IOException}
-
-import scala.collection.mutable.ArrayBuffer
-
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-class Mixer {
-
- protected val stdSeparator = "//> "
- protected val ctdSeparator = "//| "
- protected val sepColumn = 50
- protected val tabInc = 8
-
- type Comments = Seq[(Int, Array[Char])]
-
- def parseComments(comments: Array[Char]): Iterator[(Int, Array[Char])] = new Iterator[(Int, Array[Char])] {
- var idx = 0
- def hasNext = idx < comments.length
- def next() = {
- val nextSpace = comments indexOf (' ', idx)
- var nextNL = comments indexOf ('\n', nextSpace + 1)
- if (nextNL < 0) nextNL = comments.length
- val result =
- (new String(comments.slice(idx, nextSpace)).toInt, comments.slice(nextSpace + 1, nextNL))
- idx = nextNL + 1
- result
- }
- }
-
- def mix(source: Array[Char], comments: Array[Char]): Array[Char] = {
- val mixed = new ArrayBuffer[Char]
- var written = 0
- def align() = {
- var idx = mixed.lastIndexOf('\n') + 1
- var col = 0
- while (idx < mixed.length) {
- col =
- if (mixed(idx) == '\t') (col / tabInc) * tabInc + tabInc
- else col + 1
- idx += 1
- }
- if (col > sepColumn) {
- mixed += '\n'
- col = 0
- }
- while (col < sepColumn) {
- mixed += ' '
- col += 1
- }
- }
- for ((offset, cs) <- parseComments(comments)) {
- val sep =
- if (written < offset) {
- for (i <- written until offset) mixed += source(i)
- written = offset
- stdSeparator
- } else {
- mixed += '\n'
- ctdSeparator
- }
- align()
- mixed ++= sep ++= cs
- }
- mixed ++= source.view(written, source.length)
- mixed.toArray
- }
-
-}
-
-object Mixer extends Mixer {
-
- def contents(name: String): Array[Char] = {
- val page = new Array[Char](2 << 14)
- val buf = new ArrayBuffer[Char]
- val in = new FileInputStream(name)
- val rdr = new InputStreamReader(in)
- var nread = 0
- do {
- nread = rdr.read(page, 0, page.length)
- buf ++= (if (nread == page.length) page else page.take(nread))
- } while (nread >= 0)
- buf.toArray
- }
-
- def main(args: Array[String]) {
- val mixer = new Mixer
- try {
- require(args.length == 2, "required arguments: file1 file2")
- val source = contents(args(0))
- val comments = contents(args(1))
- val mixed = mixer.mix(source, comments)
- println(mixed.mkString)
- } catch {
- case ex: IOException =>
- println("error: "+ ex.getMessage)
- }
- }
-}
diff --git a/src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala b/src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala
deleted file mode 100644
index 61c1717fea..0000000000
--- a/src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala
+++ /dev/null
@@ -1,21 +0,0 @@
-package scala.tools.nsc
-package scratchpad
-
-import scala.reflect.internal.Chars._
-
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-object SourceInserter {
- def stripRight(cs: Array[Char]): Array[Char] = {
- val lines =
- new String(cs) split "\n"
- def leftPart(str: String) =
- (str split """//>|//\|""").head
- def isContinuation(str: String) =
- ((str contains "//>") || (str contains "//|")) && (leftPart(str) forall isWhitespace)
- def stripTrailingWS(str: String) =
- str take (str lastIndexWhere (!isWhitespace(_))) + 1
- val prefixes =
- lines filterNot isContinuation map leftPart map stripTrailingWS
- (prefixes mkString "\n").toArray
- }
-}
diff --git a/src/compiler/scala/tools/nsc/typechecker/NamesDefaults.scala b/src/compiler/scala/tools/nsc/typechecker/NamesDefaults.scala
index 03aad71165..46ff98875f 100644
--- a/src/compiler/scala/tools/nsc/typechecker/NamesDefaults.scala
+++ b/src/compiler/scala/tools/nsc/typechecker/NamesDefaults.scala
@@ -162,7 +162,7 @@ trait NamesDefaults { self: Analyzer =>
// never used for constructor calls, they always have a stable qualifier
def blockWithQualifier(qual: Tree, selected: Name) = {
- val sym = blockTyper.context.owner.newValue(unit.freshTermName("qual$"), qual.pos, newFlags = ARTIFACT) setInfo uncheckedBounds(qual.tpe)
+ val sym = blockTyper.context.owner.newValue(unit.freshTermName("qual$"), newFlags = ARTIFACT) setInfo uncheckedBounds(qual.tpe) setPos (qual.pos.makeTransparent)
blockTyper.context.scope enter sym
val vd = atPos(sym.pos)(ValDef(sym, qual) setType NoType)
// it stays in Vegas: SI-5720, SI-5727
@@ -173,13 +173,16 @@ trait NamesDefaults { self: Analyzer =>
// setSymbol below is important because the 'selected' function might be overloaded. by
// assigning the correct method symbol, typedSelect will just assign the type. the reason
// to still call 'typed' is to correctly infer singleton types, SI-5259.
- val f = blockTyper.typedOperator(Select(newQual, selected).setSymbol(baseFun1.symbol))
+ val selectPos =
+ if(qual.pos.isRange && baseFun.pos.isRange) qual.pos.union(baseFun.pos).withStart(Math.min(qual.pos.end, baseFun.pos.end))
+ else baseFun.pos
+ val f = blockTyper.typedOperator(Select(newQual, selected).setSymbol(baseFun1.symbol).setPos(selectPos))
if (funTargs.isEmpty) f
else TypeApply(f, funTargs).setType(baseFun.tpe)
}
val b = Block(List(vd), baseFunTransformed)
- .setType(baseFunTransformed.tpe).setPos(baseFun.pos)
+ .setType(baseFunTransformed.tpe).setPos(baseFun.pos.makeTransparent)
context.namedApplyBlockInfo =
Some((b, NamedApplyInfo(Some(newQual), defaultTargs, Nil, blockTyper)))
b
diff --git a/src/compiler/scala/tools/nsc/typechecker/Typers.scala b/src/compiler/scala/tools/nsc/typechecker/Typers.scala
index fa704adde2..8594309818 100644
--- a/src/compiler/scala/tools/nsc/typechecker/Typers.scala
+++ b/src/compiler/scala/tools/nsc/typechecker/Typers.scala
@@ -5051,7 +5051,7 @@ trait Typers extends Adaptations with Tags with TypersTracking with PatternTyper
// @M: fun is typed in TAPPmode because it is being applied to its actual type parameters
val fun1 = typed(fun, mode.forFunMode | TAPPmode)
- val tparams = fun1.symbol.typeParams
+ val tparams = if (fun1.symbol == null) Nil else fun1.symbol.typeParams
//@M TODO: val undets_fun = context.undetparams ?
// "do args first" (by restoring the context.undetparams) in order to maintain context.undetparams on the function side.
diff --git a/src/compiler/scala/tools/nsc/util/package.scala b/src/compiler/scala/tools/nsc/util/package.scala
index cb46004174..4237f36ade 100644
--- a/src/compiler/scala/tools/nsc/util/package.scala
+++ b/src/compiler/scala/tools/nsc/util/package.scala
@@ -90,51 +90,22 @@ package object util {
lazy val trace = new SimpleTracer(System.out)
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- val StringOps = scala.reflect.internal.util.StringOps
-
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- type StringOps = scala.reflect.internal.util.StringOps
-
- @deprecated("scala.reflect.internal.util.WeakHashSet", "2.10.0")
- type WeakHashSet[T <: AnyRef] = scala.reflect.internal.util.WeakHashSet[T]
-
- @deprecated("Moved to scala.reflect.internal.util.Position", "2.10.0")
- val Position = scala.reflect.internal.util.Position
-
+ // These four deprecated since 2.10.0 are still used in (at least)
+ // the sbt 0.12.4 compiler interface.
@deprecated("Moved to scala.reflect.internal.util.Position", "2.10.0")
type Position = scala.reflect.internal.util.Position
-
@deprecated("Moved to scala.reflect.internal.util.NoPosition", "2.10.0")
val NoPosition = scala.reflect.internal.util.NoPosition
-
@deprecated("Moved to scala.reflect.internal.util.FakePos", "2.10.0")
val FakePos = scala.reflect.internal.util.FakePos
-
@deprecated("Moved to scala.reflect.internal.util.FakePos", "2.10.0")
type FakePos = scala.reflect.internal.util.FakePos
- @deprecated("Moved to scala.reflect.internal.util.OffsetPosition", "2.10.0")
- type OffsetPosition = scala.reflect.internal.util.OffsetPosition
-
+ // These three were still used in scala-refactoring.
@deprecated("Moved to scala.reflect.internal.util.RangePosition", "2.10.0")
type RangePosition = scala.reflect.internal.util.RangePosition
-
@deprecated("Moved to scala.reflect.internal.util.SourceFile", "2.10.0")
type SourceFile = scala.reflect.internal.util.SourceFile
-
- @deprecated("Moved to scala.reflect.internal.util.NoSourceFile", "2.10.0")
- val NoSourceFile = scala.reflect.internal.util.NoSourceFile
-
- @deprecated("Moved to scala.reflect.internal.util.NoFile", "2.10.0")
- val NoFile = scala.reflect.internal.util.NoFile
-
- @deprecated("Moved to scala.reflect.internal.util.ScriptSourceFile", "2.10.0")
- val ScriptSourceFile = scala.reflect.internal.util.ScriptSourceFile
-
- @deprecated("Moved to scala.reflect.internal.util.ScriptSourceFile", "2.10.0")
- type ScriptSourceFile = scala.reflect.internal.util.ScriptSourceFile
-
@deprecated("Moved to scala.reflect.internal.util.BatchSourceFile", "2.10.0")
type BatchSourceFile = scala.reflect.internal.util.BatchSourceFile
diff --git a/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala b/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala
index 3901184c25..126c14ac81 100644
--- a/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala
+++ b/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala
@@ -55,9 +55,7 @@ trait Parsers { self: Quasiquotes =>
def isHole(name: Name): Boolean = holeMap.contains(name)
- override implicit def fresh: FreshNameCreator = new FreshNameCreator {
- override def newName(prefix: String) = super.newName(nme.QUASIQUOTE_PREFIX + prefix)
- }
+ override implicit def fresh: FreshNameCreator = new FreshNameCreator(nme.QUASIQUOTE_PREFIX)
override val treeBuilder = new ParserTreeBuilder {
override implicit def fresh: FreshNameCreator = parser.fresh
@@ -189,19 +187,5 @@ trait Parsers { self: Quasiquotes =>
}
}
- // Extractor that matches names which were generated by call to
- // freshTermName or freshTypeName within quasiquotes. Such names
- // have qq$some$random$prefix$0 shape where qq$ part is added
- // by modified fresh name creator in QuasiquoteParser.
- object FreshName {
- def unapply(name: Name): Option[String] =
- name.toString.split("\\$").toSeq match {
- case qq +: (middle :+ last)
- if qq + "$" == nme.QUASIQUOTE_PREFIX
- && Try(last.toInt).isSuccess && middle.nonEmpty =>
- Some(middle.mkString("", "$", "$"))
- case _ =>
- None
- }
- }
+ object FreshName extends FreshNameExtractor(nme.QUASIQUOTE_PREFIX)
} \ No newline at end of file
diff --git a/src/eclipse/README.md b/src/eclipse/README.md
index d23e10ca1c..5311651db5 100644
--- a/src/eclipse/README.md
+++ b/src/eclipse/README.md
@@ -70,7 +70,12 @@ and Eclipse .classpath of the different projects isn’t updated accordingly. Th
the build path of each project and make sure the version of the declared dependencies is in sync with the version
declared in the `version.properties` file. If it isn’t, update it manually and, when done, don’t forget to share
your changes via a pull request.
-(We are aware this is manual process is cumbersome. If you feel like scripting this process, pull requests are of course welcome.)
+(We are aware this is cumbersome. If you feel like scripting the process, pull requests are of course welcome.)
+
+Launching & Debugging scalac
+============================
+
+Read [here](http://scala-ide.org/docs/tutorials/scalac-trunk/index.html#Launching_and_Debugging_scalac).
DETAILS
=======
diff --git a/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala b/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala
index d036a6e853..69cae24808 100644
--- a/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala
+++ b/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala
@@ -62,17 +62,6 @@ trait CompilerControl { self: Global =>
def onUnitOf[T](source: SourceFile)(op: RichCompilationUnit => T): T =
op(unitOfFile.getOrElse(source.file, new RichCompilationUnit(source)))
- /** The compilation unit corresponding to a source file
- * if it does not yet exist create a new one atomically
- * Note: We want to get roid of this operation as it messes compiler invariants.
- */
- @deprecated("use getUnitOf(s) or onUnitOf(s) instead", "2.10.0")
- def unitOf(s: SourceFile): RichCompilationUnit = getOrCreateUnitOf(s)
-
- /** The compilation unit corresponding to a position */
- @deprecated("use getUnitOf(pos.source) or onUnitOf(pos.source) instead", "2.10.0")
- def unitOf(pos: Position): RichCompilationUnit = getOrCreateUnitOf(pos.source)
-
/** Removes the CompilationUnit corresponding to the given SourceFile
* from consideration for recompilation.
*/
@@ -229,18 +218,6 @@ trait CompilerControl { self: Global =>
def askParsedEntered(source: SourceFile, keepLoaded: Boolean, response: Response[Tree]) =
postWorkItem(new AskParsedEnteredItem(source, keepLoaded, response))
- /** Set sync var `response` to a pair consisting of
- * - the fully qualified name of the first top-level object definition in the file.
- * or "" if there are no object definitions.
- * - the text of the instrumented program which, when run,
- * prints its output and all defined values in a comment column.
- *
- * @param source The source file to be analyzed
- * @param response The response.
- */
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def askInstrumented(source: SourceFile, line: Int, response: Response[(String, Array[Char])]) =
- postWorkItem(new AskInstrumentedItem(source, line, response))
/** Cancels current compiler run and start a fresh one where everything will be re-typechecked
* (but not re-loaded).
@@ -250,11 +227,6 @@ trait CompilerControl { self: Global =>
/** Tells the compile server to shutdown, and not to restart again */
def askShutdown() = scheduler raise ShutdownReq
- @deprecated("use parseTree(source) instead", "2.10.0") // deleted 2nd parameter, as this has to run on 2.8 also.
- def askParse(source: SourceFile, response: Response[Tree]) = respond(response) {
- parseTree(source)
- }
-
/** Returns parse tree for source `source`. No symbols are entered. Syntax errors are reported.
*
* This method is thread-safe and as such can safely run outside of the presentation
@@ -419,15 +391,6 @@ trait CompilerControl { self: Global =>
response raise new MissingResponse
}
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- case class AskInstrumentedItem(source: SourceFile, line: Int, response: Response[(String, Array[Char])]) extends WorkItem {
- def apply() = self.getInstrumented(source, line, response)
- override def toString = "getInstrumented "+source
-
- def raiseMissing() =
- response raise new MissingResponse
- }
-
/** A do-nothing work scheduler that responds immediately with MissingResponse.
*
* Used during compiler shutdown.
diff --git a/src/interactive/scala/tools/nsc/interactive/ContextTrees.scala b/src/interactive/scala/tools/nsc/interactive/ContextTrees.scala
index 93ef4c4d6c..4f67a22b8f 100644
--- a/src/interactive/scala/tools/nsc/interactive/ContextTrees.scala
+++ b/src/interactive/scala/tools/nsc/interactive/ContextTrees.scala
@@ -6,6 +6,7 @@ package scala.tools.nsc
package interactive
import scala.collection.mutable.ArrayBuffer
+import scala.annotation.tailrec
trait ContextTrees { self: Global =>
@@ -28,44 +29,59 @@ trait ContextTrees { self: Global =>
override def toString = "ContextTree("+pos+", "+children+")"
}
- /** Optionally returns the smallest context that contains given `pos`, or None if none exists.
+ /** Returns the most precise context possible for the given `pos`.
+ *
+ * It looks for the finest ContextTree containing `pos`, and then look inside
+ * this ContextTree for a child ContextTree located immediately before `pos`.
+ * If such a child exists, returns its context, otherwise returns the context of
+ * the parent ContextTree.
+ *
+ * This is required to always return a context which contains the all the imports
+ * declared up to `pos` (see SI-7280 for a test case).
+ *
+ * Can return None if `pos` is before any valid Scala code.
*/
def locateContext(contexts: Contexts, pos: Position): Option[Context] = synchronized {
- def locateNearestContextTree(contexts: Contexts, pos: Position, recent: Array[ContextTree]): Option[ContextTree] = {
- locateContextTree(contexts, pos) match {
- case Some(x) =>
- recent(0) = x
- locateNearestContextTree(x.children, pos, recent)
- case None => recent(0) match {
- case null => None
- case x => Some(x)
- }
+ @tailrec
+ def locateFinestContextTree(context: ContextTree): ContextTree = {
+ if (context.pos includes pos) {
+ locateContextTree(context.children, pos) match {
+ case Some(x) =>
+ locateFinestContextTree(x)
+ case None =>
+ context
+ }
+ } else {
+ context
}
}
- locateNearestContextTree(contexts, pos, new Array[ContextTree](1)) map (_.context)
+ locateContextTree(contexts, pos) map locateFinestContextTree map (_.context)
}
+ /** Returns the ContextTree containing `pos`, or the ContextTree positioned just before `pos`,
+ * or None if `pos` is located before all ContextTrees.
+ */
def locateContextTree(contexts: Contexts, pos: Position): Option[ContextTree] = {
if (contexts.isEmpty) None
else {
- val hi = contexts.length - 1
- if ((contexts(hi).pos properlyPrecedes pos) || (pos properlyPrecedes contexts(0).pos)) None
- else {
- def loop(lo: Int, hi: Int): Option[ContextTree] = {
+ @tailrec
+ def loop(lo: Int, hi: Int, previousSibling: Option[ContextTree]): Option[ContextTree] = {
+ if (pos properlyPrecedes contexts(lo).pos)
+ previousSibling
+ else if (contexts(hi).pos properlyPrecedes pos)
+ Some(contexts(hi))
+ else {
val mid = (lo + hi) / 2
val midpos = contexts(mid).pos
- if ((pos precedes midpos) && (mid < hi))
- loop(lo, mid)
- else if ((midpos precedes pos) && (lo < mid))
- loop(mid, hi)
- else if (midpos includes pos)
+ if (midpos includes pos)
Some(contexts(mid))
- else if (contexts(mid+1).pos includes pos)
- Some(contexts(mid+1))
- else None
+ else if (midpos properlyPrecedes pos)
+ loop(mid + 1, hi, Some(contexts(mid)))
+ else
+ loop(lo, mid, previousSibling)
}
- loop(0, hi)
}
+ loop(0, contexts.length - 1, None)
}
}
diff --git a/src/interactive/scala/tools/nsc/interactive/Global.scala b/src/interactive/scala/tools/nsc/interactive/Global.scala
index 2790b04136..441398e443 100644
--- a/src/interactive/scala/tools/nsc/interactive/Global.scala
+++ b/src/interactive/scala/tools/nsc/interactive/Global.scala
@@ -101,7 +101,6 @@ class Global(settings: Settings, _reporter: Reporter, projectName: String = "")
with CompilerControl
with ContextTrees
with RichCompilationUnits
- with ScratchPadMaker
with Picklers {
import definitions._
@@ -1178,18 +1177,6 @@ class Global(settings: Settings, _reporter: Reporter, projectName: String = "")
}
}
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def getInstrumented(source: SourceFile, line: Int, response: Response[(String, Array[Char])]) {
- try {
- interruptsEnabled = false
- respond(response) {
- instrument(source, line)
- }
- } finally {
- interruptsEnabled = true
- }
- }
-
// ---------------- Helper classes ---------------------------
/** The typer run */
diff --git a/src/interactive/scala/tools/nsc/interactive/REPL.scala b/src/interactive/scala/tools/nsc/interactive/REPL.scala
index 33981771ec..8e9b0ceee0 100644
--- a/src/interactive/scala/tools/nsc/interactive/REPL.scala
+++ b/src/interactive/scala/tools/nsc/interactive/REPL.scala
@@ -9,7 +9,6 @@ package interactive
import scala.reflect.internal.util._
import scala.tools.nsc.reporters._
import scala.tools.nsc.io._
-import scala.tools.nsc.scratchpad.SourceInserter
import java.io.FileWriter
/** Interface of interactive compiler to a client such as an IDE
@@ -89,8 +88,6 @@ object REPL {
val completeResult = new Response[List[comp.Member]]
val typedResult = new Response[comp.Tree]
val structureResult = new Response[comp.Tree]
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- val instrumentedResult = new Response[(String, Array[Char])]
def makePos(file: String, off1: String, off2: String) = {
val source = toSourceFile(file)
@@ -112,52 +109,6 @@ object REPL {
show(structureResult)
}
- /** Write instrumented source file to disk.
- * @param iFullName The full name of the first top-level object in source
- * @param iContents An Array[Char] containing the instrumented source
- * @return The name of the instrumented source file
- */
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def writeInstrumented(iFullName: String, suffix: String, iContents: Array[Char]): String = {
- val iSimpleName = iFullName drop ((iFullName lastIndexOf '.') + 1)
- val iSourceName = iSimpleName + suffix
- val ifile = new FileWriter(iSourceName)
- ifile.write(iContents)
- ifile.close()
- iSourceName
- }
-
- /** The method for implementing worksheet functionality.
- * @param arguments a file name, followed by optional command line arguments that are passed
- * to the compiler that processes the instrumented source.
- * @param line A line number that controls uop to which line results should be produced
- * If line = -1, results are produced for all expressions in the worksheet.
- * @return The generated file content containing original source in the left column
- * and outputs in the right column, or None if the presentation compiler
- * does not respond to askInstrumented.
- */
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def instrument(arguments: List[String], line: Int): Option[(String, String)] = {
- val source = toSourceFile(arguments.head)
- // strip right hand side comment column and any trailing spaces from all lines
- val strippedContents = SourceInserter.stripRight(source.content)
- val strippedSource = new BatchSourceFile(source.file, strippedContents)
- println("stripped source = "+strippedSource+":"+strippedContents.mkString)
- comp.askReload(List(strippedSource), reloadResult)
- comp.askInstrumented(strippedSource, line, instrumentedResult)
- using(instrumentedResult) {
- case (iFullName, iContents) =>
- println(s"instrumented source $iFullName = ${iContents.mkString}")
- val iSourceName = writeInstrumented(iFullName, "$instrumented.scala", iContents)
- val sSourceName = writeInstrumented(iFullName, "$stripped.scala", strippedContents)
- (iSourceName, sSourceName)
-/*
- * val vdirOpt = compileInstrumented(iSourceName, arguments.tail)
- runInstrumented(vdirOpt, iFullName, strippedSource.content)
- */
- }
- }
-
loop { line =>
(line split " ").toList match {
case "reload" :: args =>
@@ -177,10 +128,6 @@ object REPL {
doComplete(makePos(file, off1, off2))
case List("complete", file, off1) =>
doComplete(makePos(file, off1, off1))
- case "instrument" :: arguments =>
- println(instrument(arguments, -1))
- case "instrumentTo" :: line :: arguments =>
- println(instrument(arguments, line.toInt))
case List("quit") =>
comp.askShutdown()
sys.exit(1)
@@ -195,8 +142,6 @@ object REPL {
| typeat <file> <pos>
| complete <file> <start-pos> <end-pos>
| compile <file> <pos>
- | instrument <file> <arg>*
- | instrumentTo <line-num> <file> <arg>*
| structure <file>
| quit
|""".stripMargin)
diff --git a/src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala b/src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala
deleted file mode 100644
index 2400b97d97..0000000000
--- a/src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala
+++ /dev/null
@@ -1,201 +0,0 @@
-package scala
-package tools.nsc
-package interactive
-
-import scala.reflect.internal.util.{SourceFile, BatchSourceFile, RangePosition}
-import scala.collection.mutable.ArrayBuffer
-import scala.reflect.internal.Chars.{isLineBreakChar, isWhitespace}
-import ast.parser.Tokens._
-
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-trait ScratchPadMaker { self: Global =>
-
- import definitions._
-
- private case class Patch(offset: Int, text: String)
-
- private class Patcher(contents: Array[Char], lex: LexicalStructure, endOffset: Int) extends Traverser {
- var objectName: String = ""
-
- private val patches = new ArrayBuffer[Patch]
- private val toPrint = new ArrayBuffer[String]
- private var skipped = 0
- private var resNum: Int = -1
-
- private def nextRes(): String = {
- resNum += 1
- "res$"+resNum
- }
-
- private def nameType(name: String, tpe: Type): String = {
- // if name ends in symbol character, add a space to separate it from the following ':'
- val pad = if (Character.isLetter(name.last) || Character.isDigit(name.last)) "" else " "
- name+pad+": "+tpe
- }
-
- private def nameType(sym: Symbol): String = nameType(sym.name.decoded, sym.tpe)
-
- private def literal(str: String) = "\"\"\""+str+"\"\"\""
-
- private val prologue = ";import scala.runtime.WorksheetSupport._; def main(args: Array[String])=$execute{"
-
- private val epilogue = "}"
-
- private def applyPendingPatches(offset: Int) = {
- if (skipped == 0) patches += Patch(offset, prologue)
- for (msg <- toPrint) patches += Patch(offset, ";System.out.println("+msg+")")
- toPrint.clear()
- }
-
- /** The position where to insert an instrumentation statement in front of given statement.
- * This is at the latest `stat.pos.start`. But in order not to mess with column numbers
- * in position we try to insert it at the end of the previous token instead.
- * Furthermore, `(' tokens have to be skipped because they do not show up
- * in statement range positions.
- */
- private def instrumentPos(start: Int): Int = {
- val (prevToken, prevStart, prevEnd) = lex.locate(start - 1)
- if (prevStart >= start) start
- else if (prevToken == LPAREN) instrumentPos(prevStart)
- else prevEnd
- }
-
- private def addSkip(stat: Tree): Unit = {
- val ipos = instrumentPos(stat.pos.start)
- if (stat.pos.start > skipped) applyPendingPatches(ipos)
- if (stat.pos.start >= endOffset)
- patches += Patch(ipos, ";$stop()")
- var end = stat.pos.end
- if (end > skipped) {
- while (end < contents.length && !isLineBreakChar(contents(end))) end += 1
- patches += Patch(ipos, ";$skip("+(end-skipped)+"); ")
- skipped = end
- }
- }
-
- private def addSandbox(expr: Tree) = {}
-// patches += (Patch(expr.pos.start, "sandbox("), Patch(expr.pos.end, ")"))
-
- private def resultString(prefix: String, expr: String) =
- literal(prefix + " = ") + " + $show(" + expr + ")"
-
- private def traverseStat(stat: Tree) =
- if (stat.pos.isInstanceOf[RangePosition]) {
- stat match {
- case ValDef(_, _, _, rhs) =>
- addSkip(stat)
- if (stat.symbol.isLazy)
- toPrint += literal(nameType(stat.symbol) + " = <lazy>")
- else if (!stat.symbol.isSynthetic) {
- addSandbox(rhs)
- toPrint += resultString(nameType(stat.symbol), stat.symbol.name.toString)
- }
- case DefDef(_, _, _, _, _, _) =>
- addSkip(stat)
- toPrint += literal(nameType(stat.symbol))
- case Annotated(_, arg) =>
- traverse(arg)
- case DocDef(_, defn) =>
- traverse(defn)
- case _ =>
- if (stat.isTerm) {
- addSkip(stat)
- if (stat.tpe.typeSymbol == UnitClass) {
- addSandbox(stat)
- } else {
- val resName = nextRes()
- val dispResName = resName filter ('$' != _)
- val offset = instrumentPos(stat.pos.start)
- patches += Patch(offset, "val " + resName + " = ")
- addSandbox(stat)
- toPrint += resultString(nameType(dispResName, stat.tpe), resName)
- }
- }
- }
- }
-
- override def traverse(tree: Tree): Unit = tree match {
- case PackageDef(_, _) =>
- super.traverse(tree)
- case ModuleDef(_, name, Template(_, _, body)) =>
- val topLevel = objectName.isEmpty
- if (topLevel) {
- objectName = tree.symbol.fullName
- body foreach traverseStat
- if (skipped != 0) { // don't issue prologue and epilogue if there are no instrumented statements
- applyPendingPatches(skipped)
- patches += Patch(skipped, epilogue)
- }
- }
- case _ =>
- }
-
- /** The patched text.
- * @require traverse is run first
- */
- def result: Array[Char] = {
- val reslen = contents.length + (patches map (_.text.length)).sum
- val res = Array.ofDim[Char](reslen)
- var lastOffset = 0
- var from = 0
- var to = 0
- for (Patch(offset, text) <- patches) {
- val delta = offset - lastOffset
- assert(delta >= 0)
- Array.copy(contents, from, res, to, delta)
- from += delta
- to += delta
- lastOffset = offset
- text.copyToArray(res, to)
- to += text.length
- }
- assert(contents.length - from == reslen - to)
- Array.copy(contents, from, res, to, contents.length - from)
- res
- }
- }
-
- class LexicalStructure(source: SourceFile) {
- val token = new ArrayBuffer[Int]
- val startOffset = new ArrayBuffer[Int]
- val endOffset = new ArrayBuffer[Int]
- private val scanner = new syntaxAnalyzer.UnitScanner(new CompilationUnit(source))
- scanner.init()
- while (scanner.token != EOF) {
- startOffset += scanner.offset
- token += scanner.token
- scanner.nextToken()
- endOffset += scanner.lastOffset
- }
-
- /** @return token that starts before or at offset, its startOffset, its endOffset
- */
- def locate(offset: Int): (Int, Int, Int) = {
- var lo = 0
- var hi = token.length - 1
- while (lo < hi) {
- val mid = (lo + hi + 1) / 2
- if (startOffset(mid) <= offset) lo = mid
- else hi = mid - 1
- }
- (token(lo), startOffset(lo), endOffset(lo))
- }
- }
-
- /** Compute an instrumented version of a sourcefile.
- * @param source The given sourcefile.
- * @param line The line up to which results should be printed, -1 = whole document.
- * @return A pair consisting of
- * - the fully qualified name of the first top-level object definition in the file.
- * or "" if there are no object definitions.
- * - the text of the instrumented program which, when run,
- * prints its output and all defined values in a comment column.
- */
- protected def instrument(source: SourceFile, line: Int): (String, Array[Char]) = {
- val tree = typedTree(source, forceReload = true)
- val endOffset = if (line < 0) source.length else source.lineToOffset(line + 1)
- val patcher = new Patcher(source.content, new LexicalStructure(source), endOffset)
- patcher.traverse(tree)
- (patcher.objectName, patcher.result)
- }
-}
diff --git a/src/interactive/scala/tools/nsc/interactive/tests/InteractiveTest.scala b/src/interactive/scala/tools/nsc/interactive/tests/InteractiveTest.scala
index f30d896fb7..2cb4f5fd4a 100644
--- a/src/interactive/scala/tools/nsc/interactive/tests/InteractiveTest.scala
+++ b/src/interactive/scala/tools/nsc/interactive/tests/InteractiveTest.scala
@@ -61,7 +61,7 @@ abstract class InteractiveTest
* Override this member if you need to change the default set of executed test actions.
*/
protected lazy val testActions: ListBuffer[PresentationCompilerTestDef] = {
- ListBuffer(new CompletionAction(compiler), new TypeAction(compiler), new HyperlinkAction(compiler))
+ ListBuffer(new TypeCompletionAction(compiler), new ScopeCompletionAction(compiler), new TypeAction(compiler), new HyperlinkAction(compiler))
}
/** Add new presentation compiler actions to test. Presentation compiler's test
diff --git a/src/interactive/scala/tools/nsc/interactive/tests/core/AskCommand.scala b/src/interactive/scala/tools/nsc/interactive/tests/core/AskCommand.scala
index 8d446cbbf8..4f9df6808f 100644
--- a/src/interactive/scala/tools/nsc/interactive/tests/core/AskCommand.scala
+++ b/src/interactive/scala/tools/nsc/interactive/tests/core/AskCommand.scala
@@ -42,7 +42,7 @@ trait AskParse extends AskCommand {
import compiler.Tree
/** `sources` need to be entirely parsed before running the test
- * (else commands such as `AskCompletionAt` may fail simply because
+ * (else commands such as `AskTypeCompletionAt` may fail simply because
* the source's AST is not yet loaded).
*/
def askParse(sources: Seq[SourceFile]) {
@@ -72,10 +72,10 @@ trait AskReload extends AskCommand {
}
/** Ask the presentation compiler for completion at a given position. */
-trait AskCompletionAt extends AskCommand {
+trait AskTypeCompletionAt extends AskCommand {
import compiler.Member
- private[tests] def askCompletionAt(pos: Position)(implicit reporter: Reporter): Response[List[Member]] = {
+ private[tests] def askTypeCompletionAt(pos: Position)(implicit reporter: Reporter): Response[List[Member]] = {
reporter.println("\naskTypeCompletion at " + pos.source.file.name + ((pos.line, pos.column)))
ask {
@@ -84,6 +84,19 @@ trait AskCompletionAt extends AskCommand {
}
}
+/** Ask the presentation compiler for scope completion at a given position. */
+trait AskScopeCompletionAt extends AskCommand {
+ import compiler.Member
+
+ private[tests] def askScopeCompletionAt(pos: Position)(implicit reporter: Reporter): Response[List[Member]] = {
+ reporter.println("\naskScopeCompletion at " + pos.source.file.name + ((pos.line, pos.column)))
+
+ ask {
+ compiler.askScopeCompletion(pos, _)
+ }
+ }
+}
+
/** Ask the presentation compiler for type info at a given position. */
trait AskTypeAt extends AskCommand {
import compiler.Tree
diff --git a/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala b/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala
index e28bf20745..bc490d8d45 100644
--- a/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala
+++ b/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala
@@ -12,16 +12,16 @@ private[tests] trait CoreTestDefs
/** Ask the presentation compiler for completion at all locations
* (in all sources) where the defined `marker` is found. */
- class CompletionAction(override val compiler: Global)
+ class TypeCompletionAction(override val compiler: Global)
extends PresentationCompilerTestDef
- with AskCompletionAt {
+ with AskTypeCompletionAt {
override def runTest() {
- askAllSources(CompletionMarker) { pos =>
- askCompletionAt(pos)
+ askAllSources(TypeCompletionMarker) { pos =>
+ askTypeCompletionAt(pos)
} { (pos, members) =>
withResponseDelimiter {
- reporter.println("[response] askCompletionAt " + format(pos))
+ reporter.println("[response] askTypeCompletion at " + format(pos))
// we skip getClass because it changed signature between 1.5 and 1.6, so there is no
// universal check file that we can provide for this to work
reporter.println("retrieved %d members".format(members.size))
@@ -34,6 +34,37 @@ private[tests] trait CoreTestDefs
}
}
+ /** Ask the presentation compiler for completion at all locations
+ * (in all sources) where the defined `marker` is found. */
+ class ScopeCompletionAction(override val compiler: Global)
+ extends PresentationCompilerTestDef
+ with AskScopeCompletionAt {
+
+ override def runTest() {
+ askAllSources(ScopeCompletionMarker) { pos =>
+ askScopeCompletionAt(pos)
+ } { (pos, members) =>
+ withResponseDelimiter {
+ reporter.println("[response] askScopeCompletion at " + format(pos))
+ try {
+ // exclude members not from source (don't have position), for more focused and self contained tests.
+ def eligible(sym: compiler.Symbol) = sym.pos != compiler.NoPosition
+ val filtered = members.filter(member => eligible(member.sym))
+
+ reporter.println("retrieved %d members".format(filtered.size))
+ compiler ask { () =>
+ reporter.println(filtered.map(_.forceInfoString).sorted mkString "\n")
+ }
+ } catch {
+ case t: Throwable =>
+ t.printStackTrace()
+ }
+
+ }
+ }
+ }
+ }
+
/** Ask the presentation compiler for type info at all locations
* (in all sources) where the defined `marker` is found. */
class TypeAction(override val compiler: Global)
@@ -57,7 +88,7 @@ private[tests] trait CoreTestDefs
class HyperlinkAction(override val compiler: Global)
extends PresentationCompilerTestDef
with AskTypeAt
- with AskCompletionAt {
+ with AskTypeCompletionAt {
override def runTest() {
askAllSources(HyperlinkMarker) { pos =>
diff --git a/src/interactive/scala/tools/nsc/interactive/tests/core/TestMarker.scala b/src/interactive/scala/tools/nsc/interactive/tests/core/TestMarker.scala
index a5c228a549..3f9b40277c 100644
--- a/src/interactive/scala/tools/nsc/interactive/tests/core/TestMarker.scala
+++ b/src/interactive/scala/tools/nsc/interactive/tests/core/TestMarker.scala
@@ -20,7 +20,9 @@ abstract case class TestMarker(marker: String) {
TestMarker.checkForDuplicate(this)
}
-object CompletionMarker extends TestMarker("/*!*/")
+object TypeCompletionMarker extends TestMarker("/*!*/")
+
+object ScopeCompletionMarker extends TestMarker("/*_*/")
object TypeMarker extends TestMarker("/*?*/")
diff --git a/src/library/scala/Predef.scala b/src/library/scala/Predef.scala
index cd96b5182c..8900450fa3 100644
--- a/src/library/scala/Predef.scala
+++ b/src/library/scala/Predef.scala
@@ -26,8 +26,6 @@ import scala.io.ReadStdin
* [[scala.collection.immutable.Set]], and the [[scala.collection.immutable.List]]
* constructors ([[scala.collection.immutable.::]] and
* [[scala.collection.immutable.Nil]]).
- * The types `Pair` (a [[scala.Tuple2]]) and `Triple` (a [[scala.Tuple3]]), with
- * simple constructors, are also provided.
*
* === Console I/O ===
* Predef provides a number of simple functions for console I/O, such as
@@ -230,13 +228,17 @@ object Predef extends LowPriorityImplicits with DeprecatedPredef {
// tupling ------------------------------------------------------------
+ @deprecated("Use built-in tuple syntax or Tuple2 instead", "2.11.0")
type Pair[+A, +B] = Tuple2[A, B]
+ @deprecated("Use built-in tuple syntax or Tuple2 instead", "2.11.0")
object Pair {
def apply[A, B](x: A, y: B) = Tuple2(x, y)
def unapply[A, B](x: Tuple2[A, B]): Option[Tuple2[A, B]] = Some(x)
}
+ @deprecated("Use built-in tuple syntax or Tuple3 instead", "2.11.0")
type Triple[+A, +B, +C] = Tuple3[A, B, C]
+ @deprecated("Use built-in tuple syntax or Tuple3 instead", "2.11.0")
object Triple {
def apply[A, B, C](x: A, y: B, z: C) = Tuple3(x, y, z)
def unapply[A, B, C](x: Tuple3[A, B, C]): Option[Tuple3[A, B, C]] = Some(x)
diff --git a/src/library/scala/Responder.scala b/src/library/scala/Responder.scala
index 0a42ddb0ea..8a658e252a 100644
--- a/src/library/scala/Responder.scala
+++ b/src/library/scala/Responder.scala
@@ -18,6 +18,7 @@ package scala
* @see class Responder
* @since 2.1
*/
+@deprecated("This object will be removed", "2.11.0")
object Responder {
/** Creates a responder that answer continuations with the constant `a`.
@@ -58,6 +59,7 @@ object Responder {
* @version 1.0
* @since 2.1
*/
+@deprecated("This class will be removed", "2.11.0")
abstract class Responder[+A] extends Serializable {
def respond(k: A => Unit): Unit
diff --git a/src/library/scala/annotation/migration.scala b/src/library/scala/annotation/migration.scala
index 65bee4c2cb..e71be00f32 100644
--- a/src/library/scala/annotation/migration.scala
+++ b/src/library/scala/annotation/migration.scala
@@ -25,7 +25,4 @@ package scala.annotation
*
* @since 2.8
*/
- private[scala] final class migration(message: String, changedIn: String) extends scala.annotation.StaticAnnotation {
- @deprecated("Use the constructor taking two Strings instead.", "2.10.0")
- def this(majorVersion: Int, minorVersion: Int, message: String) = this(message, majorVersion + "." + minorVersion)
- }
+ private[scala] final class migration(message: String, changedIn: String) extends scala.annotation.StaticAnnotation
diff --git a/src/library/scala/collection/immutable/IntMap.scala b/src/library/scala/collection/immutable/IntMap.scala
index 07e2ddaae2..8991d0b75a 100644
--- a/src/library/scala/collection/immutable/IntMap.scala
+++ b/src/library/scala/collection/immutable/IntMap.scala
@@ -213,7 +213,7 @@ sealed abstract class IntMap[+T] extends AbstractMap[Int, T]
}
/**
- * Loop over the keys of the map. The same as `keys.foreach(f)`, but may
+ * Loop over the values of the map. The same as `values.foreach(f)`, but may
* be more efficient.
*
* @param f The loop body
diff --git a/src/library/scala/collection/immutable/LongMap.scala b/src/library/scala/collection/immutable/LongMap.scala
index 506546c5ba..868c0c0f47 100644
--- a/src/library/scala/collection/immutable/LongMap.scala
+++ b/src/library/scala/collection/immutable/LongMap.scala
@@ -205,7 +205,7 @@ extends AbstractMap[Long, T]
}
/**
- * Loop over the keys of the map. The same as keys.foreach(f), but may
+ * Loop over the values of the map. The same as values.foreach(f), but may
* be more efficient.
*
* @param f The loop body
diff --git a/src/library/scala/collection/immutable/Range.scala b/src/library/scala/collection/immutable/Range.scala
index 34b2346851..00f398a4b0 100644
--- a/src/library/scala/collection/immutable/Range.scala
+++ b/src/library/scala/collection/immutable/Range.scala
@@ -117,22 +117,6 @@ extends scala.collection.AbstractSeq[Int]
fail()
}
- @deprecated("Range.foreach() is now self-contained, making this auxiliary method redundant.", "2.10.1")
- def validateRangeBoundaries(f: Int => Any): Boolean = {
- validateMaxLength()
-
- start != Int.MinValue || end != Int.MinValue || {
- var count = 0
- var num = start
- while (count < numRangeElements) {
- f(num)
- count += 1
- num += step
- }
- false
- }
- }
-
final def apply(idx: Int): Int = {
validateMaxLength()
if (idx < 0 || idx >= numRangeElements) throw new IndexOutOfBoundsException(idx.toString)
diff --git a/src/library/scala/collection/mutable/AnyRefMap.scala b/src/library/scala/collection/mutable/AnyRefMap.scala
new file mode 100644
index 0000000000..df74bb5187
--- /dev/null
+++ b/src/library/scala/collection/mutable/AnyRefMap.scala
@@ -0,0 +1,451 @@
+package scala
+package collection
+package mutable
+
+import generic.CanBuildFrom
+
+/** This class implements mutable maps with `AnyRef` keys based on a hash table with open addressing.
+ *
+ * Basic map operations on single entries, including `contains` and `get`,
+ * are typically significantly faster with `AnyRefMap` than [[HashMap]].
+ * Note that numbers and characters are not handled specially in AnyRefMap;
+ * only plain `equals` and `hashCode` are used in comparisons.
+ *
+ * Methods that traverse or regenerate the map, including `foreach` and `map`,
+ * are not in general faster than with `HashMap`. The methods `foreachKey`,
+ * `foreachValue`, `mapValuesNow`, and `transformValues` are, however, faster
+ * than alternative ways to achieve the same functionality.
+ *
+ * Maps with open addressing may become less efficient at lookup after
+ * repeated addition/removal of elements. Although `AnyRefMap` makes a
+ * decent attempt to remain efficient regardless, calling `repack`
+ * on a map that will no longer have elements removed but will be
+ * used heavily may save both time and storage space.
+ *
+ * This map is not indended to contain more than 2^29 entries (approximately
+ * 500 million). The maximum capacity is 2^30, but performance will degrade
+ * rapidly as 2^30 is approached.
+ *
+ */
+final class AnyRefMap[K <: AnyRef, V] private[collection] (defaultEntry: K => V, initialBufferSize: Int, initBlank: Boolean)
+extends AbstractMap[K, V]
+ with Map[K, V]
+ with MapLike[K, V, AnyRefMap[K, V]]
+{
+ import AnyRefMap._
+ def this() = this(AnyRefMap.exceptionDefault, 16, true)
+
+ /** Creates a new `AnyRefMap` that returns default values according to a supplied key-value mapping. */
+ def this(defaultEntry: K => V) = this(defaultEntry, 16, true)
+
+ /** Creates a new `AnyRefMap` with an initial buffer of specified size.
+ *
+ * An `AnyRefMap` can typically contain half as many elements as its buffer size
+ * before it requires resizing.
+ */
+ def this(initialBufferSize: Int) = this(AnyRefMap.exceptionDefault, initialBufferSize, true)
+
+ /** Creates a new `AnyRefMap` with specified default values and initial buffer size. */
+ def this(defaultEntry: K => V, initialBufferSize: Int) = this(defaultEntry, initialBufferSize, true)
+
+ private[this] var mask = 0
+ private[this] var _size = 0
+ private[this] var _vacant = 0
+ private[this] var _hashes: Array[Int] = null
+ private[this] var _keys: Array[AnyRef] = null
+ private[this] var _values: Array[AnyRef] = null
+
+ if (initBlank) defaultInitialize(initialBufferSize)
+
+ private[this] def defaultInitialize(n: Int) {
+ mask =
+ if (n<0) 0x7
+ else (((1 << (32 - java.lang.Integer.numberOfLeadingZeros(n-1))) - 1) & 0x3FFFFFFF) | 0x7
+ _hashes = new Array[Int](mask+1)
+ _keys = new Array[AnyRef](mask+1)
+ _values = new Array[AnyRef](mask+1)
+ }
+
+ private[collection] def initializeTo(
+ m: Int, sz: Int, vc: Int, hz: Array[Int], kz: Array[AnyRef], vz: Array[AnyRef]
+ ) {
+ mask = m; _size = sz; _vacant = vc; _hashes = hz; _keys = kz; _values = vz
+ }
+
+ override def size: Int = _size
+ override def empty: AnyRefMap[K,V] = new AnyRefMap(defaultEntry)
+
+ private def imbalanced: Boolean =
+ (_size + _vacant) > 0.5*mask || _vacant > _size
+
+ private def hashOf(key: K): Int = {
+ if (key eq null) 0x41081989
+ else {
+ val h = key.hashCode
+ // Part of the MurmurHash3 32 bit finalizer
+ val i = (h ^ (h >>> 16)) * 0x85EBCA6B
+ val j = (i ^ (i >>> 13))
+ if (j==0) 0x41081989 else j & 0x7FFFFFFF
+ }
+ }
+
+ private def seekEntry(h: Int, k: AnyRef): Int = {
+ var e = h & mask
+ var x = 0
+ var g = 0
+ while ({ g = _hashes(e); g != 0}) {
+ if (g == h && { val q = _keys(e); (q eq k) || ((q ne null) && (q equals k)) }) return e
+ x += 1
+ e = (e + 2*(x+1)*x - 3) & mask
+ }
+ e | MissingBit
+ }
+
+ private def seekEntryOrOpen(h: Int, k: AnyRef): Int = {
+ var e = h & mask
+ var x = 0
+ var g = 0
+ var o = -1
+ while ({ g = _hashes(e); g != 0}) {
+ if (g == h && { val q = _keys(e); (q eq k) || ((q ne null) && (q equals k)) }) return e
+ else if (o == -1 && g+g == 0) o = e
+ x += 1
+ e = (e + 2*(x+1)*x - 3) & mask
+ }
+ if (o >= 0) o | MissVacant else e | MissingBit
+ }
+
+ override def contains(key: K): Boolean = seekEntry(hashOf(key), key) >= 0
+
+ override def get(key: K): Option[V] = {
+ val i = seekEntry(hashOf(key), key)
+ if (i < 0) None else Some(_values(i).asInstanceOf[V])
+ }
+
+ override def getOrElse[V1 >: V](key: K, default: => V1): V1 = {
+ val i = seekEntry(hashOf(key), key)
+ if (i < 0) default else _values(i).asInstanceOf[V]
+ }
+
+ override def getOrElseUpdate(key: K, defaultValue: => V): V = {
+ val h = hashOf(key)
+ val i = seekEntryOrOpen(h, key)
+ if (i < 0) {
+ val value = defaultValue
+ _size += 1
+ val j = i & IndexMask
+ _hashes(j) = h
+ _keys(j) = key.asInstanceOf[AnyRef]
+ _values(j) = value.asInstanceOf[AnyRef]
+ if ((i & VacantBit) != 0) _vacant -= 1
+ else if (imbalanced) repack()
+ value
+ }
+ else _values(i).asInstanceOf[V]
+ }
+
+ /** Retrieves the value associated with a key, or the default for that type if none exists
+ * (null for AnyRef, 0 for floats and integers).
+ *
+ * Note: this is the fastest way to retrieve a value that may or
+ * may not exist, if the default null/zero is acceptable. For key/value
+ * pairs that do exist, `apply` (i.e. `map(key)`) is equally fast.
+ */
+ def getOrNull(key: K): V = {
+ val i = seekEntry(hashOf(key), key)
+ (if (i < 0) null else _values(i)).asInstanceOf[V]
+ }
+
+ /** Retrieves the value associated with a key.
+ * If the key does not exist in the map, the `defaultEntry` for that key
+ * will be returned instead; an exception will be thrown if no
+ * `defaultEntry` was supplied.
+ */
+ override def apply(key: K): V = {
+ val i = seekEntry(hashOf(key), key)
+ if (i < 0) defaultEntry(key) else _values(i).asInstanceOf[V]
+ }
+
+ /** Defers to defaultEntry to find a default value for the key. Throws an
+ * exception if no other default behavior was specified.
+ */
+ override def default(key: K) = defaultEntry(key)
+
+ private def repack(newMask: Int) {
+ val oh = _hashes
+ val ok = _keys
+ val ov = _values
+ mask = newMask
+ _hashes = new Array[Int](mask+1)
+ _keys = new Array[AnyRef](mask+1)
+ _values = new Array[AnyRef](mask+1)
+ _vacant = 0
+ var i = 0
+ while (i < oh.length) {
+ val h = oh(i)
+ if (h+h != 0) {
+ var e = h & mask
+ var x = 0
+ while (_hashes(e) != 0) { x += 1; e = (e + 2*(x+1)*x - 3) & mask }
+ _hashes(e) = h
+ _keys(e) = ok(i)
+ _values(e) = ov(i)
+ }
+ i += 1
+ }
+ }
+
+ /** Repacks the contents of this `AnyRefMap` for maximum efficiency of lookup.
+ *
+ * For maps that undergo a complex creation process with both addition and
+ * removal of keys, and then are used heavily with no further removal of
+ * elements, calling `repack` after the end of the creation can result in
+ * improved performance. Repacking takes time proportional to the number
+ * of entries in the map.
+ */
+ def repack() {
+ var m = mask
+ if (_size + _vacant >= 0.5*mask && !(_vacant > 0.2*mask)) m = ((m << 1) + 1) & IndexMask
+ while (m > 8 && 8*_size < m) m = m >>> 1
+ repack(m)
+ }
+
+ override def put(key: K, value: V): Option[V] = {
+ val h = hashOf(key)
+ val k = key
+ var i = seekEntryOrOpen(h, k)
+ if (i < 0) {
+ val j = i & IndexMask
+ _hashes(j) = h
+ _keys(j) = k
+ _values(j) = value.asInstanceOf[AnyRef]
+ _size += 1
+ if ((i & VacantBit) != 0) _vacant -= 1
+ else if (imbalanced) repack()
+ None
+ }
+ else {
+ val ans = Some(_values(i).asInstanceOf[V])
+ _hashes(i) = h
+ _keys(i) = k
+ _values(i) = value.asInstanceOf[AnyRef]
+ ans
+ }
+ }
+
+ /** Updates the map to include a new key-value pair.
+ *
+ * This is the fastest way to add an entry to an `AnyRefMap`.
+ */
+ override def update(key: K, value: V): Unit = {
+ val h = hashOf(key)
+ val k = key
+ var i = seekEntryOrOpen(h, k)
+ if (i < 0) {
+ val j = i & IndexMask
+ _hashes(j) = h
+ _keys(j) = k
+ _values(j) = value.asInstanceOf[AnyRef]
+ _size += 1
+ if ((i & VacantBit) != 0) _vacant -= 1
+ else if (imbalanced) repack()
+ }
+ else {
+ _hashes(i) = h
+ _keys(i) = k
+ _values(i) = value.asInstanceOf[AnyRef]
+ }
+ }
+
+ /** Adds a new key/value pair to this map and returns the map. */
+ def +=(key: K, value: V): this.type = { update(key, value); this }
+
+ def +=(kv: (K, V)): this.type = { update(kv._1, kv._2); this }
+
+ def -=(key: K): this.type = {
+ val i = seekEntry(hashOf(key), key)
+ if (i >= 0) {
+ _size -= 1
+ _vacant += 1
+ _hashes(i) = Int.MinValue
+ _keys(i) = null
+ _values(i) = null
+ }
+ this
+ }
+
+ def iterator: Iterator[(K, V)] = new Iterator[(K, V)] {
+ private[this] val hz = _hashes
+ private[this] val kz = _keys
+ private[this] val vz = _values
+
+ private[this] var index = 0
+ private[this] var found = false
+
+ def hasNext = found || (index<hz.length && {
+ var h = hz(index)
+ if (h+h != 0) found = true
+ else {
+ index += 1
+ while (index < hz.length && { h = hz(index); h+h == 0 }) index += 1
+ found = (index < hz.length)
+ }
+ found
+ })
+
+ def next = {
+ if (found || hasNext) {
+ val ans = (_keys(index).asInstanceOf[K], _values(index).asInstanceOf[V])
+ index += 1
+ found = false
+ ans
+ }
+ else throw new NoSuchElementException("next")
+ }
+ }
+
+ override def foreach[A](f: ((K,V)) => A) {
+ var i = 0
+ var e = _size
+ while (e > 0) {
+ while(i < _hashes.length && { val h = _hashes(i); h+h == 0 && i < _hashes.length}) i += 1
+ if (i < _hashes.length) {
+ f((_keys(i).asInstanceOf[K], _values(i).asInstanceOf[V]))
+ i += 1
+ e -= 1
+ }
+ else return
+ }
+ }
+
+ override def clone(): AnyRefMap[K, V] = {
+ val hz = java.util.Arrays.copyOf(_hashes, _hashes.length)
+ val kz = java.util.Arrays.copyOf(_keys, _keys.length)
+ val vz = java.util.Arrays.copyOf(_values, _values.length)
+ val arm = new AnyRefMap[K, V](defaultEntry, 1, false)
+ arm.initializeTo(mask, _size, _vacant, hz, kz, vz)
+ arm
+ }
+
+ private[this] def foreachElement[A,B](elems: Array[AnyRef], f: A => B) {
+ var i,j = 0
+ while (i < _hashes.length & j < _size) {
+ val h = _hashes(i)
+ if (h+h != 0) {
+ j += 1
+ f(elems(i).asInstanceOf[A])
+ }
+ i += 1
+ }
+ }
+
+ /** Applies a function to all keys of this map. */
+ def foreachKey[A](f: K => A) { foreachElement[K,A](_keys, f) }
+
+ /** Applies a function to all values of this map. */
+ def foreachValue[A](f: V => A) { foreachElement[V,A](_values, f) }
+
+ /** Creates a new `AnyRefMap` with different values.
+ * Unlike `mapValues`, this method generates a new
+ * collection immediately.
+ */
+ def mapValuesNow[V1](f: V => V1): AnyRefMap[K, V1] = {
+ val arm = new AnyRefMap[K,V1](AnyRefMap.exceptionDefault, 1, false)
+ val hz = java.util.Arrays.copyOf(_hashes, _hashes.length)
+ val kz = java.util.Arrays.copyOf(_keys, _keys.length)
+ val vz = new Array[AnyRef](_values.length)
+ var i,j = 0
+ while (i < _hashes.length & j < _size) {
+ val h = _hashes(i)
+ if (h+h != 0) {
+ j += 1
+ vz(i) = f(_values(i).asInstanceOf[V]).asInstanceOf[AnyRef]
+ }
+ i += 1
+ }
+ arm.initializeTo(mask, _size, _vacant, hz, kz, vz)
+ arm
+ }
+
+ /** Applies a transformation function to all values stored in this map.
+ * Note: the default, if any, is not transformed.
+ */
+ def transformValues(f: V => V): this.type = {
+ var i,j = 0
+ while (i < _hashes.length & j < _size) {
+ val h = _hashes(i)
+ if (h+h != 0) {
+ j += 1
+ _values(i) = f(_values(i).asInstanceOf[V]).asInstanceOf[AnyRef]
+ }
+ i += 1
+ }
+ this
+ }
+
+}
+
+object AnyRefMap {
+ private final val IndexMask = 0x3FFFFFFF
+ private final val MissingBit = 0x80000000
+ private final val VacantBit = 0x40000000
+ private final val MissVacant = 0xC0000000
+
+ private val exceptionDefault = (k: Any) => throw new NoSuchElementException(if (k == null) "(null)" else k.toString)
+
+ implicit def canBuildFrom[K <: AnyRef, V, J <: AnyRef, U]: CanBuildFrom[AnyRefMap[K,V], (J, U), AnyRefMap[J,U]] =
+ new CanBuildFrom[AnyRefMap[K,V], (J, U), AnyRefMap[J,U]] {
+ def apply(from: AnyRefMap[K,V]): AnyRefMapBuilder[J, U] = apply()
+ def apply(): AnyRefMapBuilder[J, U] = new AnyRefMapBuilder[J, U]
+ }
+
+ final class AnyRefMapBuilder[K <: AnyRef, V] extends Builder[(K, V), AnyRefMap[K, V]] {
+ private[collection] var elems: AnyRefMap[K, V] = new AnyRefMap[K, V]
+ def +=(entry: (K, V)): this.type = {
+ elems += entry
+ this
+ }
+ def clear() { elems = new AnyRefMap[K, V] }
+ def result(): AnyRefMap[K, V] = elems
+ }
+
+ /** Creates a new `AnyRefMap` with zero or more key/value pairs. */
+ def apply[K <: AnyRef, V](elems: (K, V)*): AnyRefMap[K, V] = {
+ val sz = if (elems.hasDefiniteSize) elems.size else 4
+ val arm = new AnyRefMap[K, V](sz * 2)
+ elems.foreach{ case (k,v) => arm(k) = v }
+ if (arm.size < (sz>>3)) arm.repack()
+ arm
+ }
+
+ /** Creates a new empty `AnyRefMap`. */
+ def empty[K <: AnyRef, V]: AnyRefMap[K, V] = new AnyRefMap[K, V]
+
+ /** Creates a new empty `AnyRefMap` with the supplied default */
+ def withDefault[K <: AnyRef, V](default: K => V): AnyRefMap[K, V] = new AnyRefMap[K, V](default)
+
+ /** Creates a new `AnyRefMap` from arrays of keys and values.
+ * Equivalent to but more efficient than `AnyRefMap((keys zip values): _*)`.
+ */
+ def fromZip[K <: AnyRef, V](keys: Array[K], values: Array[V]): AnyRefMap[K, V] = {
+ val sz = math.min(keys.length, values.length)
+ val arm = new AnyRefMap[K, V](sz * 2)
+ var i = 0
+ while (i < sz) { arm(keys(i)) = values(i); i += 1 }
+ if (arm.size < (sz>>3)) arm.repack()
+ arm
+ }
+
+ /** Creates a new `AnyRefMap` from keys and values.
+ * Equivalent to but more efficient than `AnyRefMap((keys zip values): _*)`.
+ */
+ def fromZip[K <: AnyRef, V](keys: Iterable[K], values: Iterable[V]): AnyRefMap[K, V] = {
+ val sz = math.min(keys.size, values.size)
+ val arm = new AnyRefMap[K, V](sz * 2)
+ val ki = keys.iterator
+ val vi = values.iterator
+ while (ki.hasNext && vi.hasNext) arm(ki.next) = vi.next
+ if (arm.size < (sz >> 3)) arm.repack()
+ arm
+ }
+}
diff --git a/src/library/scala/collection/mutable/LongMap.scala b/src/library/scala/collection/mutable/LongMap.scala
new file mode 100644
index 0000000000..81c381279f
--- /dev/null
+++ b/src/library/scala/collection/mutable/LongMap.scala
@@ -0,0 +1,558 @@
+package scala
+package collection
+package mutable
+
+import generic.CanBuildFrom
+
+/** This class implements mutable maps with `Long` keys based on a hash table with open addressing.
+ *
+ * Basic map operations on single entries, including `contains` and `get`,
+ * are typically substantially faster with `LongMap` than [[HashMap]]. Methods
+ * that act on the whole map, including `foreach` and `map` are not in
+ * general expected to be faster than with a generic map, save for those
+ * that take particular advantage of the internal structure of the map:
+ * `foreachKey`, `foreachValue`, `mapValuesNow`, and `transformValues`.
+ *
+ * Maps with open addressing may become less efficient at lookup after
+ * repeated addition/removal of elements. Although `LongMap` makes a
+ * decent attempt to remain efficient regardless, calling `repack`
+ * on a map that will no longer have elements removed but will be
+ * used heavily may save both time and storage space.
+ *
+ * This map is not indended to contain more than 2^29 entries (approximately
+ * 500 million). The maximum capacity is 2^30, but performance will degrade
+ * rapidly as 2^30 is approached.
+ *
+ */
+final class LongMap[V] private[collection] (defaultEntry: Long => V, initialBufferSize: Int, initBlank: Boolean)
+extends AbstractMap[Long, V]
+ with Map[Long, V]
+ with MapLike[Long, V, LongMap[V]]
+ with Serializable
+{
+ import LongMap._
+
+ def this() = this(LongMap.exceptionDefault, 16, true)
+
+ /** Creates a new `LongMap` that returns default values according to a supplied key-value mapping. */
+ def this(defaultEntry: Long => V) = this(defaultEntry, 16, true)
+
+ /** Creates a new `LongMap` with an initial buffer of specified size.
+ *
+ * A LongMap can typically contain half as many elements as its buffer size
+ * before it requires resizing.
+ */
+ def this(initialBufferSize: Int) = this(LongMap.exceptionDefault, initialBufferSize, true)
+
+ /** Creates a new `LongMap` with specified default values and initial buffer size. */
+ def this(defaultEntry: Long => V, initialBufferSize: Int) = this(defaultEntry, initialBufferSize, true)
+
+ private[this] var mask = 0
+ private[this] var extraKeys: Int = 0
+ private[this] var zeroValue: AnyRef = null
+ private[this] var minValue: AnyRef = null
+ private[this] var _size = 0
+ private[this] var _vacant = 0
+ private[this] var _keys: Array[Long] = null
+ private[this] var _values: Array[AnyRef] = null
+
+ if (initBlank) defaultInitialize(initialBufferSize)
+
+ private[this] def defaultInitialize(n: Int) = {
+ mask =
+ if (n<0) 0x7
+ else (((1 << (32 - java.lang.Integer.numberOfLeadingZeros(n-1))) - 1) & 0x3FFFFFFF) | 0x7
+ _keys = new Array[Long](mask+1)
+ _values = new Array[AnyRef](mask+1)
+ }
+
+ private[collection] def initializeTo(
+ m: Int, ek: Int, zv: AnyRef, mv: AnyRef, sz: Int, vc: Int, kz: Array[Long], vz: Array[AnyRef]
+ ) {
+ mask = m; extraKeys = ek; zeroValue = zv; minValue = mv; _size = sz; _vacant = vc; _keys = kz; _values = vz
+ }
+
+ override def size: Int = _size + (extraKeys+1)/2
+ override def empty: LongMap[V] = new LongMap()
+
+ private def imbalanced: Boolean =
+ (_size + _vacant) > 0.5*mask || _vacant > _size
+
+ private def toIndex(k: Long): Int = {
+ // Part of the MurmurHash3 32 bit finalizer
+ val h = ((k ^ (k >>> 32)) & 0xFFFFFFFFL).toInt
+ var x = (h ^ (h >>> 16)) * 0x85EBCA6B
+ (x ^ (x >>> 13)) & mask
+ }
+
+ private def seekEmpty(k: Long): Int = {
+ var e = toIndex(k)
+ var x = 0
+ while (_keys(e) != 0) { x += 1; e = (e + 2*(x+1)*x - 3) & mask }
+ e
+ }
+
+ private def seekEntry(k: Long): Int = {
+ var e = toIndex(k)
+ var x = 0
+ var q = 0L
+ while ({ q = _keys(e); if (q==k) return e; q != 0}) { x += 1; e = (e + 2*(x+1)*x - 3) & mask }
+ e | MissingBit
+ }
+
+ private def seekEntryOrOpen(k: Long): Int = {
+ var e = toIndex(k)
+ var x = 0
+ var q = 0L
+ while ({ q = _keys(e); if (q==k) return e; q+q != 0}) {
+ x += 1
+ e = (e + 2*(x+1)*x - 3) & mask
+ }
+ if (q == 0) return e | MissingBit
+ val o = e | MissVacant
+ while ({ q = _keys(e); if (q==k) return e; q != 0}) {
+ x += 1
+ e = (e + 2*(x+1)*x - 3) & mask
+ }
+ o
+ }
+
+ override def contains(key: Long): Boolean = {
+ if (key == -key) (((key>>>63).toInt+1) & extraKeys) != 0
+ else seekEntry(key) >= 0
+ }
+
+ override def get(key: Long): Option[V] = {
+ if (key == -key) {
+ if ((((key>>>63).toInt+1) & extraKeys) == 0) None
+ else if (key == 0) Some(zeroValue.asInstanceOf[V])
+ else Some(minValue.asInstanceOf[V])
+ }
+ else {
+ val i = seekEntry(key)
+ if (i < 0) None else Some(_values(i).asInstanceOf[V])
+ }
+ }
+
+ override def getOrElse[V1 >: V](key: Long, default: => V1): V1 = {
+ if (key == -key) {
+ if ((((key>>>63).toInt+1) & extraKeys) == 0) default
+ else if (key == 0) zeroValue.asInstanceOf[V1]
+ else minValue.asInstanceOf[V1]
+ }
+ else {
+ val i = seekEntry(key)
+ if (i < 0) default else _values(i).asInstanceOf[V1]
+ }
+ }
+
+ override def getOrElseUpdate(key: Long, defaultValue: => V): V = {
+ if (key == -key) {
+ val kbits = (key>>>63).toInt + 1
+ if ((kbits & extraKeys) == 0) {
+ val value = defaultValue
+ extraKeys |= kbits
+ if (key == 0) zeroValue = value.asInstanceOf[AnyRef]
+ else minValue = value.asInstanceOf[AnyRef]
+ value
+ }
+ else if (key == 0) zeroValue.asInstanceOf[V]
+ else minValue.asInstanceOf[V]
+ }
+ else {
+ val i = seekEntryOrOpen(key)
+ if (i < 0) {
+ val value = defaultValue
+ _size += 1
+ val j = i & IndexMask
+ _keys(j) = key
+ _values(j) = value.asInstanceOf[AnyRef]
+ if ((i & VacantBit) != 0) _vacant -= 1
+ else if (imbalanced) repack()
+ value
+ }
+ else _values(i).asInstanceOf[V]
+ }
+ }
+
+ /** Retrieves the value associated with a key, or the default for that type if none exists
+ * (null for AnyRef, 0 for floats and integers).
+ *
+ * Note: this is the fastest way to retrieve a value that may or
+ * may not exist, if the default null/zero is acceptable. For key/value
+ * pairs that do exist, `apply` (i.e. `map(key)`) is equally fast.
+ */
+ def getOrNull(key: Long): V = {
+ if (key == -key) {
+ if ((((key>>>63).toInt+1) & extraKeys) == 0) null.asInstanceOf[V]
+ else if (key == 0) zeroValue.asInstanceOf[V]
+ else minValue.asInstanceOf[V]
+ }
+ else {
+ val i = seekEntry(key)
+ if (i < 0) null.asInstanceOf[V] else _values(i).asInstanceOf[V]
+ }
+ }
+
+ /** Retrieves the value associated with a key.
+ * If the key does not exist in the map, the `defaultEntry` for that key
+ * will be returned instead.
+ */
+ override def apply(key: Long): V = {
+ if (key == -key) {
+ if ((((key>>>63).toInt+1) & extraKeys) == 0) defaultEntry(key)
+ else if (key == 0) zeroValue.asInstanceOf[V]
+ else minValue.asInstanceOf[V]
+ }
+ else {
+ val i = seekEntry(key)
+ if (i < 0) defaultEntry(key) else _values(i).asInstanceOf[V]
+ }
+ }
+
+ /** The user-supplied default value for the key. Throws an exception
+ * if no other default behavior was specified.
+ */
+ override def default(key: Long) = defaultEntry(key)
+
+ private def repack(newMask: Int) {
+ val ok = _keys
+ val ov = _values
+ mask = newMask
+ _keys = new Array[Long](mask+1)
+ _values = new Array[AnyRef](mask+1)
+ _vacant = 0
+ var i = 0
+ while (i < ok.length) {
+ val k = ok(i)
+ if (k != -k) {
+ val j = seekEmpty(k)
+ _keys(j) = k
+ _values(j) = ov(i)
+ }
+ i += 1
+ }
+ }
+
+ /** Repacks the contents of this `LongMap` for maximum efficiency of lookup.
+ *
+ * For maps that undergo a complex creation process with both addition and
+ * removal of keys, and then are used heavily with no further removal of
+ * elements, calling `repack` after the end of the creation can result in
+ * improved performance. Repacking takes time proportional to the number
+ * of entries in the map.
+ */
+ def repack() {
+ var m = mask
+ if (_size + _vacant >= 0.5*mask && !(_vacant > 0.2*mask)) m = ((m << 1) + 1) & IndexMask
+ while (m > 8 && 8*_size < m) m = m >>> 1
+ repack(m)
+ }
+
+ override def put(key: Long, value: V): Option[V] = {
+ if (key == -key) {
+ if (key == 0) {
+ val ans = if ((extraKeys&1) == 1) Some(zeroValue.asInstanceOf[V]) else None
+ zeroValue = value.asInstanceOf[AnyRef]
+ extraKeys |= 1
+ ans
+ }
+ else {
+ val ans = if ((extraKeys&2) == 1) Some(minValue.asInstanceOf[V]) else None
+ minValue = value.asInstanceOf[AnyRef]
+ extraKeys |= 2
+ ans
+ }
+ }
+ else {
+ val i = seekEntryOrOpen(key)
+ if (i < 0) {
+ val j = i & IndexMask
+ _keys(j) = key
+ _values(j) = value.asInstanceOf[AnyRef]
+ _size += 1
+ if ((i & VacantBit) != 0) _vacant -= 1
+ else if (imbalanced) repack()
+ None
+ }
+ else {
+ val ans = Some(_values(i).asInstanceOf[V])
+ _keys(i) = key
+ _values(i) = value.asInstanceOf[AnyRef]
+ ans
+ }
+ }
+ }
+
+ /** Updates the map to include a new key-value pair.
+ *
+ * This is the fastest way to add an entry to a `LongMap`.
+ */
+ override def update(key: Long, value: V): Unit = {
+ if (key == -key) {
+ if (key == 0) {
+ zeroValue = value.asInstanceOf[AnyRef]
+ extraKeys |= 1
+ }
+ else {
+ minValue = value.asInstanceOf[AnyRef]
+ extraKeys |= 2
+ }
+ }
+ else {
+ var i = seekEntryOrOpen(key)
+ if (i < 0) {
+ val j = i & IndexMask
+ _keys(j) = key
+ _values(j) = value.asInstanceOf[AnyRef]
+ _size += 1
+ if ((i & VacantBit) != 0) _vacant -= 1
+ else if (imbalanced) repack()
+ }
+ else {
+ _keys(i) = key
+ _values(i) = value.asInstanceOf[AnyRef]
+ }
+ }
+ }
+
+ /** Adds a new key/value pair to this map and returns the map. */
+ def +=(key: Long, value: V): this.type = { update(key, value); this }
+
+ def +=(kv: (Long, V)): this.type = { update(kv._1, kv._2); this }
+
+ def -=(key: Long): this.type = {
+ if (key == -key) {
+ if (key == 0L) {
+ extraKeys &= 0x2
+ zeroValue = null
+ }
+ else {
+ extraKeys &= 0x1
+ minValue = null
+ }
+ }
+ else {
+ val i = seekEntry(key)
+ if (i >= 0) {
+ _size -= 1
+ _vacant += 1
+ _keys(i) = Long.MinValue
+ _values(i) = null
+ }
+ }
+ this
+ }
+
+ def iterator: Iterator[(Long, V)] = new Iterator[(Long, V)] {
+ private[this] val kz = _keys
+ private[this] val vz = _values
+
+ private[this] var nextPair: (Long, V) =
+ if (extraKeys==0) null
+ else if ((extraKeys&1)==1) (0L, zeroValue.asInstanceOf[V])
+ else (Long.MinValue, minValue.asInstanceOf[V])
+
+ private[this] var anotherPair: (Long, V) =
+ if (extraKeys==3) (Long.MinValue, minValue.asInstanceOf[V])
+ else null
+
+ private[this] var index = 0
+
+ def hasNext: Boolean = nextPair != null || (index < kz.length && {
+ var q = kz(index)
+ while (q == -q) {
+ index += 1
+ if (index >= kz.length) return false
+ q = kz(index)
+ }
+ nextPair = (kz(index), vz(index).asInstanceOf[V])
+ index += 1
+ true
+ })
+ def next = {
+ if (nextPair == null && !hasNext) throw new NoSuchElementException("next")
+ val ans = nextPair
+ if (anotherPair != null) {
+ nextPair = anotherPair
+ anotherPair = null
+ }
+ nextPair = null
+ ans
+ }
+ }
+
+ override def foreach[A](f: ((Long,V)) => A) {
+ var i,j = 0
+ while (i < _keys.length & j < _size) {
+ val k = _keys(i)
+ if (k != -k) {
+ j += 1
+ f((k, _values(i).asInstanceOf[V]))
+ }
+ i += 1
+ }
+ if ((extraKeys & 1) == 1) f((0L, zeroValue.asInstanceOf[V]))
+ if ((extraKeys & 2) == 2) f((Long.MinValue, minValue.asInstanceOf[V]))
+ }
+
+ override def clone(): LongMap[V] = {
+ val kz = java.util.Arrays.copyOf(_keys, _keys.length)
+ val vz = java.util.Arrays.copyOf(_values, _values.length)
+ val lm = new LongMap[V](defaultEntry, 1, false)
+ lm.initializeTo(mask, extraKeys, zeroValue, minValue, _size, _vacant, kz, vz)
+ lm
+ }
+
+ /** Applies a function to all keys of this map. */
+ def foreachKey[A](f: Long => A) {
+ var i,j = 0
+ while (i < _keys.length & j < _size) {
+ val k = _keys(i)
+ if (k != -k) {
+ j += 1
+ f(k)
+ }
+ i += 1
+ }
+ if ((extraKeys & 1) == 1) f(0L)
+ if ((extraKeys & 2) == 2) f(Long.MinValue)
+ }
+
+ /** Applies a function to all values of this map. */
+ def foreachValue[A](f: V => A) {
+ var i,j = 0
+ while (i < _keys.length & j < _size) {
+ val k = _keys(i)
+ if (k != -k) {
+ j += 1
+ f(_values(i).asInstanceOf[V])
+ }
+ i += 1
+ }
+ if ((extraKeys & 1) == 1) f(zeroValue.asInstanceOf[V])
+ if ((extraKeys & 2) == 2) f(minValue.asInstanceOf[V])
+ }
+
+ /** Creates a new `LongMap` with different values.
+ * Unlike `mapValues`, this method generates a new
+ * collection immediately.
+ */
+ def mapValuesNow[V1](f: V => V1): LongMap[V1] = {
+ val lm = new LongMap[V1](LongMap.exceptionDefault, 1, false)
+ val kz = java.util.Arrays.copyOf(_keys, _keys.length)
+ val vz = new Array[AnyRef](_values.length)
+ var i,j = 0
+ while (i < _keys.length & j < _size) {
+ val k = _keys(i)
+ if (k != -k) {
+ j += 1
+ vz(i) = f(_values(i).asInstanceOf[V]).asInstanceOf[AnyRef]
+ }
+ i += 1
+ }
+ val zv = if ((extraKeys & 1) == 1) f(zeroValue.asInstanceOf[V]).asInstanceOf[AnyRef] else null
+ val mv = if ((extraKeys & 2) == 2) f(minValue.asInstanceOf[V]).asInstanceOf[AnyRef] else null
+ lm.initializeTo(mask, extraKeys, zv, mv, _size, _vacant, kz, vz)
+ lm
+ }
+
+ /** Applies a transformation function to all values stored in this map.
+ * Note: the default, if any, is not transformed.
+ */
+ def transformValues(f: V => V): this.type = {
+ var i,j = 0
+ while (i < _keys.length & j < _size) {
+ val k = _keys(i)
+ if (k != -k) {
+ j += 1
+ _values(i) = f(_values(i).asInstanceOf[V]).asInstanceOf[AnyRef]
+ }
+ i += 1
+ }
+ if ((extraKeys & 1) == 1) zeroValue = f(zeroValue.asInstanceOf[V]).asInstanceOf[AnyRef]
+ if ((extraKeys & 2) == 2) minValue = f(minValue.asInstanceOf[V]).asInstanceOf[AnyRef]
+ this
+ }
+
+ /*
+ override def toString = {
+ val sb = new StringBuilder("LongMap(")
+ var n = 0
+ foreach{ case (k,v) =>
+ if (n > 0) sb ++= ", "
+ sb ++= k.toString
+ sb ++= " -> "
+ sb ++= v.toString
+ n += 1
+ }
+ sb += ')'
+ sb.result
+ }
+ */
+}
+
+object LongMap {
+ private final val IndexMask = 0x3FFFFFFF
+ private final val MissingBit = 0x80000000
+ private final val VacantBit = 0x40000000
+ private final val MissVacant = 0xC0000000
+
+ private val exceptionDefault: Long => Nothing = (k: Long) => throw new NoSuchElementException(k.toString)
+
+ implicit def canBuildFrom[V, U]: CanBuildFrom[LongMap[V], (Long, U), LongMap[U]] =
+ new CanBuildFrom[LongMap[V], (Long, U), LongMap[U]] {
+ def apply(from: LongMap[V]): LongMapBuilder[U] = apply()
+ def apply(): LongMapBuilder[U] = new LongMapBuilder[U]
+ }
+
+ final class LongMapBuilder[V] extends Builder[(Long, V), LongMap[V]] {
+ private[collection] var elems: LongMap[V] = new LongMap[V]
+ def +=(entry: (Long, V)): this.type = {
+ elems += entry
+ this
+ }
+ def clear() { elems = new LongMap[V] }
+ def result(): LongMap[V] = elems
+ }
+
+ /** Creates a new `LongMap` with zero or more key/value pairs. */
+ def apply[V](elems: (Long, V)*): LongMap[V] = {
+ val sz = if (elems.hasDefiniteSize) elems.size else 4
+ val lm = new LongMap[V](sz * 2)
+ elems.foreach{ case (k,v) => lm(k) = v }
+ if (lm.size < (sz>>3)) lm.repack()
+ lm
+ }
+
+ /** Creates a new empty `LongMap`. */
+ def empty[V]: LongMap[V] = new LongMap[V]
+
+ /** Creates a new empty `LongMap` with the supplied default */
+ def withDefault[V](default: Long => V): LongMap[V] = new LongMap[V](default)
+
+ /** Creates a new `LongMap` from arrays of keys and values.
+ * Equivalent to but more efficient than `LongMap((keys zip values): _*)`.
+ */
+ def fromZip[V](keys: Array[Long], values: Array[V]): LongMap[V] = {
+ val sz = math.min(keys.length, values.length)
+ val lm = new LongMap[V](sz * 2)
+ var i = 0
+ while (i < sz) { lm(keys(i)) = values(i); i += 1 }
+ if (lm.size < (sz>>3)) lm.repack()
+ lm
+ }
+
+ /** Creates a new `LongMap` from keys and values.
+ * Equivalent to but more efficient than `LongMap((keys zip values): _*)`.
+ */
+ def fromZip[V](keys: Iterable[Long], values: Iterable[V]): LongMap[V] = {
+ val sz = math.min(keys.size, values.size)
+ val lm = new LongMap[V](sz * 2)
+ val ki = keys.iterator
+ val vi = values.iterator
+ while (ki.hasNext && vi.hasNext) lm(ki.next) = vi.next
+ if (lm.size < (sz >> 3)) lm.repack()
+ lm
+ }
+}
diff --git a/src/library/scala/concurrent/Future.scala b/src/library/scala/concurrent/Future.scala
index dd86af0dd4..f905785bd6 100644
--- a/src/library/scala/concurrent/Future.scala
+++ b/src/library/scala/concurrent/Future.scala
@@ -488,7 +488,7 @@ object Future {
*/
def apply[T](body: =>T)(implicit @deprecatedName('execctx) executor: ExecutionContext): Future[T] = impl.Future(body)
- /** Simple version of `Futures.traverse`. Transforms a `TraversableOnce[Future[A]]` into a `Future[TraversableOnce[A]]`.
+ /** Simple version of `Future.traverse`. Transforms a `TraversableOnce[Future[A]]` into a `Future[TraversableOnce[A]]`.
* Useful for reducing many `Future`s into a single `Future`.
*/
def sequence[A, M[_] <: TraversableOnce[_]](in: M[Future[A]])(implicit cbf: CanBuildFrom[M[Future[A]], A, M[A]], executor: ExecutionContext): Future[M[A]] = {
diff --git a/src/library/scala/math/BigDecimal.scala b/src/library/scala/math/BigDecimal.scala
index 0a2da16523..d783dd29f5 100644
--- a/src/library/scala/math/BigDecimal.scala
+++ b/src/library/scala/math/BigDecimal.scala
@@ -158,8 +158,7 @@ object BigDecimal {
* @author Stephane Micheloud
* @version 1.0
*/
-@deprecatedInheritance("This class will be made final.", "2.10.0")
-class BigDecimal(
+final class BigDecimal(
val bigDecimal: BigDec,
val mc: MathContext)
extends ScalaNumber with ScalaNumericConversions with Serializable {
diff --git a/src/library/scala/math/BigInt.scala b/src/library/scala/math/BigInt.scala
index b25dbefebd..5e70bdc2f6 100644
--- a/src/library/scala/math/BigInt.scala
+++ b/src/library/scala/math/BigInt.scala
@@ -109,8 +109,7 @@ object BigInt {
* @author Martin Odersky
* @version 1.0, 15/07/2003
*/
-@deprecatedInheritance("This class will be made final.", "2.10.0")
-class BigInt(val bigInteger: BigInteger) extends ScalaNumber with ScalaNumericConversions with Serializable {
+final class BigInt(val bigInteger: BigInteger) extends ScalaNumber with ScalaNumericConversions with Serializable {
/** Returns the hash code for this BigInt. */
override def hashCode(): Int =
if (isValidLong) unifiedPrimitiveHashcode()
diff --git a/src/library/scala/reflect/ClassManifestDeprecatedApis.scala b/src/library/scala/reflect/ClassManifestDeprecatedApis.scala
index 798746851a..ca7a3cddb8 100644
--- a/src/library/scala/reflect/ClassManifestDeprecatedApis.scala
+++ b/src/library/scala/reflect/ClassManifestDeprecatedApis.scala
@@ -16,6 +16,7 @@ import java.lang.{ Class => jClass }
trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
self: ClassManifest[T] =>
+ // Still in use in target test.junit.comp.
@deprecated("Use runtimeClass instead", "2.10.0")
def erasure: jClass[_] = runtimeClass
@@ -64,12 +65,12 @@ trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
// when the erasure is the same, even before considering variance.
!cannotMatch && {
// this part is wrong for not considering variance
- if (this.erasure == that.erasure)
+ if (this.runtimeClass == that.runtimeClass)
subargs(this.typeArguments, that.typeArguments)
// this part is wrong for punting unless the rhs has no type
// arguments, but it's better than a blindfolded pinata swing.
else
- that.typeArguments.isEmpty && subtype(this.erasure, that.erasure)
+ that.typeArguments.isEmpty && subtype(this.runtimeClass, that.runtimeClass)
}
}
@@ -91,29 +92,29 @@ trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
@deprecated("Use wrap instead", "2.10.0")
def arrayManifest: ClassManifest[Array[T]] =
- ClassManifest.classType[Array[T]](arrayClass[T](erasure), this)
+ ClassManifest.classType[Array[T]](arrayClass[T](runtimeClass), this)
override def newArray(len: Int): Array[T] =
- java.lang.reflect.Array.newInstance(erasure, len).asInstanceOf[Array[T]]
+ java.lang.reflect.Array.newInstance(runtimeClass, len).asInstanceOf[Array[T]]
@deprecated("Use wrap.newArray instead", "2.10.0")
def newArray2(len: Int): Array[Array[T]] =
- java.lang.reflect.Array.newInstance(arrayClass[T](erasure), len)
+ java.lang.reflect.Array.newInstance(arrayClass[T](runtimeClass), len)
.asInstanceOf[Array[Array[T]]]
@deprecated("Use wrap.wrap.newArray instead", "2.10.0")
def newArray3(len: Int): Array[Array[Array[T]]] =
- java.lang.reflect.Array.newInstance(arrayClass[Array[T]](arrayClass[T](erasure)), len)
+ java.lang.reflect.Array.newInstance(arrayClass[Array[T]](arrayClass[T](runtimeClass)), len)
.asInstanceOf[Array[Array[Array[T]]]]
@deprecated("Use wrap.wrap.wrap.newArray instead", "2.10.0")
def newArray4(len: Int): Array[Array[Array[Array[T]]]] =
- java.lang.reflect.Array.newInstance(arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](erasure))), len)
+ java.lang.reflect.Array.newInstance(arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](runtimeClass))), len)
.asInstanceOf[Array[Array[Array[Array[T]]]]]
@deprecated("Use wrap.wrap.wrap.wrap.newArray instead", "2.10.0")
def newArray5(len: Int): Array[Array[Array[Array[Array[T]]]]] =
- java.lang.reflect.Array.newInstance(arrayClass[Array[Array[Array[T]]]](arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](erasure)))), len)
+ java.lang.reflect.Array.newInstance(arrayClass[Array[Array[Array[T]]]](arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](runtimeClass)))), len)
.asInstanceOf[Array[Array[Array[Array[Array[T]]]]]]
@deprecated("Create WrappedArray directly instead", "2.10.0")
@@ -131,7 +132,7 @@ trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
protected def argString =
if (typeArguments.nonEmpty) typeArguments.mkString("[", ", ", "]")
- else if (erasure.isArray) "["+ClassManifest.fromClass(erasure.getComponentType)+"]"
+ else if (runtimeClass.isArray) "["+ClassManifest.fromClass(runtimeClass.getComponentType)+"]"
else ""
}
@@ -221,7 +222,7 @@ object ClassManifestFactory {
*/
def abstractType[T](prefix: OptManifest[_], name: String, upperbound: ClassManifest[_], args: OptManifest[_]*): ClassManifest[T] =
new ClassManifest[T] {
- override def runtimeClass = upperbound.erasure
+ override def runtimeClass = upperbound.runtimeClass
override val typeArguments = args.toList
override def toString = prefix.toString+"#"+name+argString
}
@@ -236,6 +237,6 @@ private class ClassTypeManifest[T](
{
override def toString =
(if (prefix.isEmpty) "" else prefix.get.toString+"#") +
- (if (erasure.isArray) "Array" else erasure.getName) +
+ (if (runtimeClass.isArray) "Array" else runtimeClass.getName) +
argString
} \ No newline at end of file
diff --git a/src/library/scala/reflect/Manifest.scala b/src/library/scala/reflect/Manifest.scala
index 3bc76da295..803c980058 100644
--- a/src/library/scala/reflect/Manifest.scala
+++ b/src/library/scala/reflect/Manifest.scala
@@ -46,7 +46,7 @@ trait Manifest[T] extends ClassManifest[T] with Equals {
override def typeArguments: List[Manifest[_]] = Nil
override def arrayManifest: Manifest[Array[T]] =
- Manifest.classType[Array[T]](arrayClass[T](erasure), this)
+ Manifest.classType[Array[T]](arrayClass[T](runtimeClass), this)
override def canEqual(that: Any): Boolean = that match {
case _: Manifest[_] => true
@@ -56,10 +56,10 @@ trait Manifest[T] extends ClassManifest[T] with Equals {
* faster than <:< and rules out most comparisons.
*/
override def equals(that: Any): Boolean = that match {
- case m: Manifest[_] => (m canEqual this) && (this.erasure == m.erasure) && (this <:< m) && (m <:< this)
+ case m: Manifest[_] => (m canEqual this) && (this.runtimeClass == m.runtimeClass) && (this <:< m) && (m <:< this)
case _ => false
}
- override def hashCode = this.erasure.##
+ override def hashCode = this.runtimeClass.##
}
// TODO undeprecated until Scala reflection becomes non-experimental
@@ -238,7 +238,7 @@ object ManifestFactory {
override val typeArguments: List[Manifest[_]]) extends Manifest[T] {
override def toString =
(if (prefix.isEmpty) "" else prefix.get.toString+"#") +
- (if (erasure.isArray) "Array" else erasure.getName) +
+ (if (runtimeClass.isArray) "Array" else runtimeClass.getName) +
argString
}
@@ -259,7 +259,7 @@ object ManifestFactory {
*/
def wildcardType[T](lowerBound: Manifest[_], upperBound: Manifest[_]): Manifest[T] =
new Manifest[T] {
- def runtimeClass = upperBound.erasure
+ def runtimeClass = upperBound.runtimeClass
override def toString =
"_" +
(if (lowerBound eq Nothing) "" else " >: "+lowerBound) +
@@ -269,7 +269,7 @@ object ManifestFactory {
/** Manifest for the intersection type `parents_0 with ... with parents_n'. */
def intersectionType[T](parents: Manifest[_]*): Manifest[T] =
new Manifest[T] {
- def runtimeClass = parents.head.erasure
+ def runtimeClass = parents.head.runtimeClass
override def toString = parents.mkString(" with ")
}
}
diff --git a/src/library/scala/runtime/WorksheetSupport.scala b/src/library/scala/runtime/WorksheetSupport.scala
deleted file mode 100644
index d86f8873aa..0000000000
--- a/src/library/scala/runtime/WorksheetSupport.scala
+++ /dev/null
@@ -1,93 +0,0 @@
-package scala.runtime
-import java.io.{OutputStream, PrintStream}
-import scala.runtime.ScalaRunTime.stringOf
-
-/** A utility object that's needed by the code that executes a worksheet.
- */
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-object WorksheetSupport {
-
- /** The offset in the source which should be printed */
- private var currentOffset = 0
-
- /** A stream that flushes in regular intervals so that output can be captured
- * in real time. The flush interval is determined by the field "flushInterval".
- * By default it is 30ms.
- */
- private class FlushedOutputStream(out: OutputStream) extends OutputStream {
- protected def flushInterval = 30000000L // interval between flushes, by default 30ms
- protected def width = 80 // output width, by default 80 characters
- protected def tabInc = 8 // tab increment, by default 8 characters
- private var lastFlush: Long = 0L
- private var col = -1
- override def write(b: Array[Byte], off: Int, len: Int) = {
- for (idx <- off until (off + len min b.length)) writeOne(b(idx).toInt)
- flush()
- }
- override def write(c: Int) {
- writeOne(c)
- flush()
- }
- override def flush() {
- val current = System.nanoTime
- if (current - lastFlush >= flushInterval) {
- out.flush()
- lastFlush = current
- }
- }
- def writeOne(c: Int) {
- if (col < 0) {
- col = 0
- write((currentOffset+" ").getBytes)
- }
- out.write(c)
- col =
- if (c == '\n') -1
- else if (c == '\t') (col / tabInc) * tabInc + tabInc
- else col + 1
- if (col >= width) writeOne('\n')
- }
- def ensureNewLine() = if (col > 0) writeOne('\n')
- }
-
- private val flushedOut = new FlushedOutputStream(System.out)
- private val printOut = new PrintStream(flushedOut)
-
- private def redirected(op: => Unit) = {
- val oldSysOut = System.out
- val oldSysErr = System.err
- val oldConsOut = Console.out
- val oldConsErr = Console.err
- System.setOut(printOut)
- System.setErr(printOut)
- Console.setOut(printOut)
- Console.setErr(printOut)
- try op
- finally {
- printOut.close()
- System.setOut(oldSysOut)
- System.setErr(oldSysErr)
- Console.setOut(oldConsOut)
- Console.setErr(oldConsErr)
- }
- }
-
- def $execute(op: => Unit) = redirected {
- try op
- catch {
- case ex: StopException => ;
- case ex: Throwable => ex.printStackTrace()
- }
- }
-
- def $skip(n: Int) = {
- flushedOut.ensureNewLine()
- currentOffset += n
- }
-
- def $stop() = throw new StopException
-
- def $show(x: Any): String = stringOf(x)
-}
-
-class StopException extends Exception
diff --git a/src/library/scala/util/hashing/MurmurHash3.scala b/src/library/scala/util/hashing/MurmurHash3.scala
index c85664349e..1bfaeb255b 100644
--- a/src/library/scala/util/hashing/MurmurHash3.scala
+++ b/src/library/scala/util/hashing/MurmurHash3.scala
@@ -275,12 +275,4 @@ object MurmurHash3 extends MurmurHash3 {
finalizeHash(h, n)
}
*/
-
- @deprecated("Use unorderedHash", "2.10.0")
- final def symmetricHash[T](xs: scala.collection.GenTraversableOnce[T], seed: Int = symmetricSeed): Int =
- unorderedHash(xs.seq, seed)
-
- @deprecated("Use orderedHash", "2.10.0")
- final def traversableHash[T](xs: scala.collection.GenTraversableOnce[T], seed: Int = traversableSeed): Int =
- orderedHash(xs.seq, seed)
}
diff --git a/src/manual/scala/man1/scala.scala b/src/manual/scala/man1/scala.scala
index dbd4ea55a2..f48b99bd5a 100644
--- a/src/manual/scala/man1/scala.scala
+++ b/src/manual/scala/man1/scala.scala
@@ -55,7 +55,7 @@ object scala extends Command {
CmdOption("savecompiled"),
"Save this compiled version of scripts in order to speed up " &
"later executions of the same script. When running a script, " &
- "save the compiled version of in a file with the same name as the " &
+ "save the compiled version in a file with the same name as the " &
"script but with an extension of " & Mono(".jar") & ". On subsequent " &
"runs of the same script, the pre-compiled " & Mono(".jar") & " file " &
"will be used if it is newer than the script file."),
diff --git a/src/reflect/scala/reflect/api/JavaUniverse.scala b/src/reflect/scala/reflect/api/JavaUniverse.scala
index 6fc76c9693..df5e0699a5 100644
--- a/src/reflect/scala/reflect/api/JavaUniverse.scala
+++ b/src/reflect/scala/reflect/api/JavaUniverse.scala
@@ -34,7 +34,7 @@ trait JavaUniverse extends Universe with JavaMirrors { self =>
mirror.universe match {
case ju: JavaUniverse =>
val jm = mirror.asInstanceOf[ju.Mirror]
- val sym = jm.classSymbol(manifest.erasure)
+ val sym = jm.classSymbol(manifest.runtimeClass)
val tpe =
if (manifest.typeArguments.isEmpty) sym.toType
else ju.appliedType(sym.toTypeConstructor, manifest.typeArguments map (targ => ju.manifestToTypeTag(jm, targ)) map (_.in(jm).tpe))
diff --git a/src/reflect/scala/reflect/internal/Definitions.scala b/src/reflect/scala/reflect/internal/Definitions.scala
index 563f23cb3b..19f06894c8 100644
--- a/src/reflect/scala/reflect/internal/Definitions.scala
+++ b/src/reflect/scala/reflect/internal/Definitions.scala
@@ -16,7 +16,7 @@ import scala.reflect.api.{Universe => ApiUniverse}
trait Definitions extends api.StandardDefinitions {
self: SymbolTable =>
- import rootMirror.{getModule, getPackage, getClassByName, getRequiredClass, getRequiredModule, getClassIfDefined, getModuleIfDefined, getPackageObject, getPackageIfDefined, getPackageObjectIfDefined, requiredClass, requiredModule}
+ import rootMirror.{getModuleByName, getPackage, getClassByName, getRequiredClass, getRequiredModule, getClassIfDefined, getModuleIfDefined, getPackageObject, getPackageIfDefined, getPackageObjectIfDefined, requiredClass, requiredModule}
object definitions extends DefinitionsClass
@@ -87,7 +87,7 @@ trait Definitions extends api.StandardDefinitions {
lazy val abbrvTag = symbolsMap(ScalaValueClasses, nameToTag) withDefaultValue OBJECT_TAG
lazy val numericWeight = symbolsMapFilt(ScalaValueClasses, nameToWeight.keySet, nameToWeight)
- lazy val boxedModule = classesMap(x => getModule(boxedName(x)))
+ lazy val boxedModule = classesMap(x => getModuleByName(boxedName(x)))
lazy val boxedClass = classesMap(x => getClassByName(boxedName(x)))
lazy val refClass = classesMap(x => getRequiredClass("scala.runtime." + x + "Ref"))
lazy val volatileRefClass = classesMap(x => getRequiredClass("scala.runtime.Volatile" + x + "Ref"))
@@ -153,18 +153,6 @@ trait Definitions extends api.StandardDefinitions {
private var isInitialized = false
def isDefinitionsInitialized = isInitialized
- @deprecated("Moved to rootMirror.RootPackage", "2.10.0")
- val RootPackage: ModuleSymbol = rootMirror.RootPackage
-
- @deprecated("Moved to rootMirror.RootClass", "2.10.0")
- val RootClass: ClassSymbol = rootMirror.RootClass
-
- @deprecated("Moved to rootMirror.EmptyPackage", "2.10.0")
- val EmptyPackage: ModuleSymbol = rootMirror.EmptyPackage
-
- @deprecated("Moved to rootMirror.EmptyPackageClass", "2.10.0")
- val EmptyPackageClass: ClassSymbol = rootMirror.EmptyPackageClass
-
// It becomes tricky to create dedicated objects for other symbols because
// of initialization order issues.
lazy val JavaLangPackage = getPackage("java.lang")
diff --git a/src/reflect/scala/reflect/internal/FreshNames.scala b/src/reflect/scala/reflect/internal/FreshNames.scala
new file mode 100644
index 0000000000..bb488aa2a8
--- /dev/null
+++ b/src/reflect/scala/reflect/internal/FreshNames.scala
@@ -0,0 +1,35 @@
+/* NSC -- new Scala compiler
+ * Copyright 2005-2013 LAMP/EPFL
+ */
+
+package scala
+package reflect
+package internal
+
+import scala.reflect.internal.util.FreshNameCreator
+
+trait FreshNames { self: Names =>
+ // default fresh name creator used to abstract over currentUnit.fresh and runtime fresh name creator
+ def currentFreshNameCreator: FreshNameCreator
+
+ // create fresh term/type name using implicit fresh name creator
+ def freshTermName(prefix: String = "x$")(implicit creator: FreshNameCreator): TermName = newTermName(creator.newName(prefix))
+ def freshTypeName(prefix: String)(implicit creator: FreshNameCreator): TypeName = newTypeName(creator.newName(prefix))
+
+ // Extractor that matches names which were generated by some
+ // FreshNameCreator with known prefix. Extracts user-specified
+ // prefix that was used as a parameter to newName by stripping
+ // global creator prefix and unique number in the end of the name.
+ class FreshNameExtractor(creatorPrefix: String = "") {
+ // quote prefix so that it can be used with replaceFirst
+ // which expects regExp rather than simple string
+ val quotedCreatorPrefix = java.util.regex.Pattern.quote(creatorPrefix)
+
+ def unapply(name: Name): Option[String] = {
+ val sname = name.toString
+ // name should start with creatorPrefix and end with number
+ if (!sname.startsWith(creatorPrefix) || !sname.matches("^.*\\d*$")) None
+ else Some(NameTransformer.decode(sname.replaceFirst(quotedCreatorPrefix, "").replaceAll("\\d*$", "")))
+ }
+ }
+} \ No newline at end of file
diff --git a/src/reflect/scala/reflect/internal/Mirrors.scala b/src/reflect/scala/reflect/internal/Mirrors.scala
index e122fa498b..3a630b6a16 100644
--- a/src/reflect/scala/reflect/internal/Mirrors.scala
+++ b/src/reflect/scala/reflect/internal/Mirrors.scala
@@ -96,10 +96,6 @@ trait Mirrors extends api.Mirrors {
}
}
- @deprecated("Use getClassByName", "2.10.0")
- def getClass(fullname: Name): ClassSymbol =
- getClassByName(fullname)
-
def getClassByName(fullname: Name): ClassSymbol =
ensureClassSymbol(fullname.toString, getModuleOrClass(fullname.toTypeName))
@@ -131,15 +127,11 @@ trait Mirrors extends api.Mirrors {
case _ => MissingRequirementError.notFound("object " + fullname)
}
- @deprecated("Use getModuleByName", "2.10.0")
- def getModule(fullname: Name): ModuleSymbol =
- getModuleByName(fullname)
-
def getModuleByName(fullname: Name): ModuleSymbol =
ensureModuleSymbol(fullname.toString, getModuleOrClass(fullname.toTermName), allowPackages = true)
def getRequiredModule(fullname: String): ModuleSymbol =
- getModule(newTermNameCached(fullname))
+ getModuleByName(newTermNameCached(fullname))
// TODO: What syntax do we think should work here? Say you have an object
// like scala.Predef. You can't say requiredModule[scala.Predef] since there's
@@ -155,7 +147,7 @@ trait Mirrors extends api.Mirrors {
getModuleIfDefined(newTermNameCached(fullname))
def getModuleIfDefined(fullname: Name): Symbol =
- wrapMissing(getModule(fullname.toTermName))
+ wrapMissing(getModuleByName(fullname.toTermName))
/** @inheritdoc
*
diff --git a/src/reflect/scala/reflect/internal/SymbolTable.scala b/src/reflect/scala/reflect/internal/SymbolTable.scala
index 4998580a7d..c3f3e35fb3 100644
--- a/src/reflect/scala/reflect/internal/SymbolTable.scala
+++ b/src/reflect/scala/reflect/internal/SymbolTable.scala
@@ -42,6 +42,7 @@ abstract class SymbolTable extends macros.Universe
with BuildUtils
with PrivateWithin
with pickling.Translations
+ with FreshNames
{
val gen = new TreeGen { val global: SymbolTable.this.type = SymbolTable.this }
@@ -398,11 +399,6 @@ abstract class SymbolTable extends macros.Universe
* Adds the `sm` String interpolator to a [[scala.StringContext]].
*/
implicit val StringContextStripMarginOps: StringContext => StringContextStripMarginOps = util.StringContextStripMarginOps
-
- // fresh name creation
- def currentFreshNameCreator: FreshNameCreator
- def freshTermName(prefix: String = "x$")(implicit creator: FreshNameCreator): TermName = newTermName(creator.newName(prefix))
- def freshTypeName(prefix: String)(implicit creator: FreshNameCreator): TypeName = newTypeName(creator.newName(prefix))
}
object SymbolTableStats {
diff --git a/src/reflect/scala/reflect/internal/Symbols.scala b/src/reflect/scala/reflect/internal/Symbols.scala
index bd17c18119..85bc3158f6 100644
--- a/src/reflect/scala/reflect/internal/Symbols.scala
+++ b/src/reflect/scala/reflect/internal/Symbols.scala
@@ -452,23 +452,6 @@ trait Symbols extends api.Symbols { self: SymbolTable =>
case _ => new StubTermSymbol(this, name.toTermName, missingMessage)
}
- @deprecated("Use the other signature", "2.10.0")
- def newClass(pos: Position, name: TypeName): Symbol = newClass(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newModuleClass(pos: Position, name: TypeName): Symbol = newModuleClass(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newLabel(pos: Position, name: TermName): MethodSymbol = newLabel(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newValue(pos: Position, name: TermName): TermSymbol = newTermSymbol(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newAliasType(pos: Position, name: TypeName): Symbol = newAliasType(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newAbstractType(pos: Position, name: TypeName): Symbol = newAbstractType(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newExistential(pos: Position, name: TypeName): Symbol = newExistential(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newMethod(pos: Position, name: TermName): MethodSymbol = newMethod(name, pos)
-
// ----- locking and unlocking ------------------------------------------------------
// True if the symbol is unlocked.
@@ -2047,10 +2030,6 @@ trait Symbols extends api.Symbols { self: SymbolTable =>
else if (isMethod || isClass) this
else owner.logicallyEnclosingMember
- /** Kept for source compatibility with 2.9. Scala IDE for Eclipse relies on this. */
- @deprecated("Use enclosingTopLevelClass", "2.10.0")
- def toplevelClass: Symbol = enclosingTopLevelClass
-
/** The top-level class containing this symbol. */
def enclosingTopLevelClass: Symbol =
if (isTopLevel) {
@@ -2365,9 +2344,6 @@ trait Symbols extends api.Symbols { self: SymbolTable =>
def associatedFile: AbstractFile = enclosingTopLevelClass.associatedFile
def associatedFile_=(f: AbstractFile) { abort("associatedFile_= inapplicable for " + this) }
- @deprecated("Use associatedFile_= instead", "2.10.0")
- def sourceFile_=(f: AbstractFile): Unit = associatedFile_=(f)
-
/** If this is a sealed class, its known direct subclasses.
* Otherwise, the empty set.
*/
diff --git a/src/reflect/scala/reflect/internal/TreeInfo.scala b/src/reflect/scala/reflect/internal/TreeInfo.scala
index 8982fd4246..a933a5d189 100644
--- a/src/reflect/scala/reflect/internal/TreeInfo.scala
+++ b/src/reflect/scala/reflect/internal/TreeInfo.scala
@@ -848,7 +848,7 @@ abstract class TreeInfo {
})
def isMacroApplication(tree: Tree): Boolean =
- !tree.isDef && tree.symbol != null && tree.symbol.isMacro && !tree.symbol.isErroneous
+ !tree.isDef && tree.symbol != null && tree.symbol.isTermMacro && !tree.symbol.isErroneous
def isMacroApplicationOrBlock(tree: Tree): Boolean = tree match {
case Block(_, expr) => isMacroApplicationOrBlock(expr)
diff --git a/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala b/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala
index 3e54de8e1e..8442c1015f 100644
--- a/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala
+++ b/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala
@@ -11,7 +11,7 @@ import java.util.concurrent.atomic.AtomicLong
import scala.collection.mutable
import scala.reflect.NameTransformer
-class FreshNameCreator {
+class FreshNameCreator(creatorPrefix: String = "") {
protected val counters = new ConcurrentHashMap[String, AtomicLong]()
/**
@@ -21,7 +21,8 @@ class FreshNameCreator {
*/
def newName(prefix: String): String = {
val safePrefix = NameTransformer.encode(prefix)
- counters.putIfAbsent(safePrefix, new AtomicLong(0));
- safePrefix + counters.get(safePrefix).incrementAndGet();
+ counters.putIfAbsent(safePrefix, new AtomicLong(0))
+ val idx = counters.get(safePrefix).incrementAndGet()
+ s"$creatorPrefix$safePrefix$idx"
}
}
diff --git a/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala b/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala
index bce506ee0a..344f7682c1 100644
--- a/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala
+++ b/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala
@@ -51,6 +51,7 @@ trait JavaUniverseForce { self: runtime.JavaUniverse =>
// inaccessible: this.SimpleNameOrdering
this.traceSymbols
this.perRunCaches
+ this.FreshNameExtractor
this.FixedMirrorTreeCreator
this.FixedMirrorTypeCreator
this.CompoundTypeTreeOriginalAttachment
diff --git a/src/repl/scala/tools/nsc/interpreter/IMain.scala b/src/repl/scala/tools/nsc/interpreter/IMain.scala
index 0d55423247..8fba1e538e 100644
--- a/src/repl/scala/tools/nsc/interpreter/IMain.scala
+++ b/src/repl/scala/tools/nsc/interpreter/IMain.scala
@@ -9,10 +9,11 @@ package interpreter
import PartialFunction.cond
import scala.language.implicitConversions
+import scala.beans.BeanProperty
import scala.collection.mutable
import scala.concurrent.{ Future, ExecutionContext }
import scala.reflect.runtime.{ universe => ru }
-import scala.reflect.{ BeanProperty, ClassTag, classTag }
+import scala.reflect.{ ClassTag, classTag }
import scala.reflect.internal.util.{ BatchSourceFile, SourceFile }
import scala.tools.util.PathResolver
import scala.tools.nsc.io.AbstractFile
diff --git a/src/repl/scala/tools/nsc/interpreter/JavapClass.scala b/src/repl/scala/tools/nsc/interpreter/JavapClass.scala
index 50c90968af..496d5face1 100644
--- a/src/repl/scala/tools/nsc/interpreter/JavapClass.scala
+++ b/src/repl/scala/tools/nsc/interpreter/JavapClass.scala
@@ -180,7 +180,7 @@ class JavapClass(
/** Base class for javap tool adapters for java 6 and 7. */
abstract class JavapTool {
type ByteAry = Array[Byte]
- type Input = Pair[String, Try[ByteAry]]
+ type Input = Tuple2[String, Try[ByteAry]]
/** Run the tool. */
def apply(raw: Boolean, options: Seq[String])(inputs: Seq[Input]): List[JpResult]
diff --git a/src/scaladoc/scala/tools/ant/Scaladoc.scala b/src/scaladoc/scala/tools/ant/Scaladoc.scala
index fd6d637212..36a1405b11 100644
--- a/src/scaladoc/scala/tools/ant/Scaladoc.scala
+++ b/src/scaladoc/scala/tools/ant/Scaladoc.scala
@@ -574,7 +574,7 @@ class Scaladoc extends ScalaMatchingTask {
\*============================================================================*/
/** Initializes settings and source files */
- protected def initialize: Pair[Settings, List[File]] = {
+ protected def initialize: Tuple2[Settings, List[File]] = {
// Tests if all mandatory attributes are set and valid.
if (origin.isEmpty) buildError("Attribute 'srcdir' is not set.")
if (getOrigin.isEmpty) buildError("Attribute 'srcdir' is not set.")
@@ -660,14 +660,14 @@ class Scaladoc extends ScalaMatchingTask {
log("Scaladoc params = '" + addParams + "'", Project.MSG_DEBUG)
docSettings processArgumentString addParams
- Pair(docSettings, sourceFiles)
+ (docSettings, sourceFiles)
}
def safeBuildError(message: String): Unit = if (nofail) log(message) else buildError(message)
/** Performs the compilation. */
override def execute() = {
- val Pair(docSettings, sourceFiles) = initialize
+ val (docSettings, sourceFiles) = initialize
val reporter = new ConsoleReporter(docSettings)
try {
val docProcessor = new scala.tools.nsc.doc.DocFactory(reporter, docSettings)
diff --git a/src/scalap/scala/tools/scalap/Arguments.scala b/src/scalap/scala/tools/scalap/Arguments.scala
index 41346d13c0..cb0a92b6b3 100644
--- a/src/scalap/scala/tools/scalap/Arguments.scala
+++ b/src/scalap/scala/tools/scalap/Arguments.scala
@@ -46,8 +46,8 @@ object Arguments {
}
def parseBinding(str: String, separator: Char): (String, String) = (str indexOf separator) match {
- case -1 => argumentError("missing '" + separator + "' in binding '" + str + "'") ; Pair("", "")
- case idx => Pair((str take idx).trim, (str drop (idx + 1)).trim)
+ case -1 => argumentError("missing '" + separator + "' in binding '" + str + "'") ; ("", "")
+ case idx => ((str take idx).trim, (str drop (idx + 1)).trim)
}
def parse(args: Array[String]): Arguments = {
@@ -141,7 +141,7 @@ class Arguments {
if (key.length > 0)
bindings.getOrElseUpdate(tag, new mutable.HashMap)(key) = value
- def addBinding(tag: String, binding: Pair[String, String]): Unit =
+ def addBinding(tag: String, binding: Tuple2[String, String]): Unit =
addBinding(tag, binding._1, binding._2)
def addOther(arg: String): Unit = others += arg
diff --git a/test/disabled/run/lisp.scala b/test/disabled/run/lisp.scala
index 06e68f508a..73f24da757 100644
--- a/test/disabled/run/lisp.scala
+++ b/test/disabled/run/lisp.scala
@@ -12,11 +12,11 @@ class LispTokenizer(s: String) extends Iterator[String] {
while (i < s.length() && s.charAt(i) <= ' ') i += 1
i < s.length()
}
- def next: String =
+ def next: String =
if (hasNext) {
val start = i
if (isDelimiter(s charAt i)) i += 1
- else
+ else
do i = i + 1
while (!isDelimiter(s charAt i))
s.substring(start, i)
@@ -190,10 +190,10 @@ object LispCaseClasses extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
@@ -381,10 +381,10 @@ object LispAny extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
diff --git a/test/files/jvm/typerep.scala b/test/files/jvm/typerep.scala
index 1d6f0b7907..4f900d98d7 100644
--- a/test/files/jvm/typerep.scala
+++ b/test/files/jvm/typerep.scala
@@ -86,7 +86,7 @@ object testArrays {
object testTuples {
println(getType((3, "abc")))
- println(getType(Triple('a', 'b', "c")))
+ println(getType(('a', 'b', "c")))
println(getType(((3, "abc"), (4, "xyz"))))
println(getType(((Some('b'), 3), (Some('a'), 4))))
//println(getType(((Some('b'), 3), (None, 4))))
diff --git a/test/files/neg/class-of-double-targs.check b/test/files/neg/class-of-double-targs.check
new file mode 100644
index 0000000000..f7e2094f97
--- /dev/null
+++ b/test/files/neg/class-of-double-targs.check
@@ -0,0 +1,4 @@
+class-of-double-targs.scala:2: error: expression of type Class[Int](classOf[scala.Int]) does not take type parameters.
+ classOf[Int][Int]
+ ^
+one error found
diff --git a/test/files/neg/class-of-double-targs.scala b/test/files/neg/class-of-double-targs.scala
new file mode 100644
index 0000000000..26a2fa8381
--- /dev/null
+++ b/test/files/neg/class-of-double-targs.scala
@@ -0,0 +1,3 @@
+object Test {
+ classOf[Int][Int]
+}
diff --git a/test/files/neg/patmatexhaust.scala b/test/files/neg/patmatexhaust.scala
index aa7dac7d7d..f937197829 100644
--- a/test/files/neg/patmatexhaust.scala
+++ b/test/files/neg/patmatexhaust.scala
@@ -22,9 +22,9 @@ class TestSealedExhaustive { // compile only
def ma3(x:Mult) = (x,x) match { // not exhaustive
case (Kult(_), Qult()) => // Kult missing
- //case Pair(Kult(_), Kult(_)) =>
+ //case (Kult(_), Kult(_)) =>
case (Qult(), Kult(_)) => // Qult missing
- //case Pair(Qult(), Qult()) =>
+ //case (Qult(), Qult()) =>
}
def ma3u(x:Mult) = ((x,x) : @unchecked) match { // not exhaustive, but not checked!
diff --git a/test/files/neg/t414.scala b/test/files/neg/t414.scala
index 1662b9a105..86646d13c2 100644
--- a/test/files/neg/t414.scala
+++ b/test/files/neg/t414.scala
@@ -1,5 +1,5 @@
case class Empty[a]() extends IntMap[a];
-case class Node[a](left: IntMap[a], keyVal: Pair[Int, a], right: IntMap[a]) extends IntMap[a];
+case class Node[a](left: IntMap[a], keyVal: Tuple2[Int, a], right: IntMap[a]) extends IntMap[a];
abstract class IntMap[a] {
def lookup(key: Int): a = this match {
case Empty =>
diff --git a/test/files/neg/t5702-neg-bad-and-wild.check b/test/files/neg/t5702-neg-bad-and-wild.check
index ff9e5e5703..a52136dbf8 100644
--- a/test/files/neg/t5702-neg-bad-and-wild.check
+++ b/test/files/neg/t5702-neg-bad-and-wild.check
@@ -23,6 +23,6 @@ t5702-neg-bad-and-wild.scala:23: error: bad simple pattern: bad use of _* (a seq
val K(ns @ _*, x) = k // bad use of _* (a sequence pattern must be the last pattern)
^
t5702-neg-bad-and-wild.scala:24: error: bad simple pattern: bad use of _* (sequence pattern not allowed)
- val (b, _ * ) = Pair(5,6) // bad use of _* (sequence pattern not allowed)
+ val (b, _ * ) = (5,6) // bad use of _* (sequence pattern not allowed)
^
9 errors found
diff --git a/test/files/neg/t5702-neg-bad-and-wild.scala b/test/files/neg/t5702-neg-bad-and-wild.scala
index 3833a002b1..aadda37da7 100644
--- a/test/files/neg/t5702-neg-bad-and-wild.scala
+++ b/test/files/neg/t5702-neg-bad-and-wild.scala
@@ -21,7 +21,7 @@ object Test {
//gowild.scala:14: error: star patterns must correspond with varargs parameters
val K(is @ _*) = k
val K(ns @ _*, x) = k // bad use of _* (a sequence pattern must be the last pattern)
- val (b, _ * ) = Pair(5,6) // bad use of _* (sequence pattern not allowed)
+ val (b, _ * ) = (5,6) // bad use of _* (sequence pattern not allowed)
// no longer complains
//bad-and-wild.scala:15: error: ')' expected but '}' found.
}
diff --git a/test/files/neg/t7605-deprecation.check b/test/files/neg/t7605-deprecation.check
index 9c466c058c..6db94613a1 100644
--- a/test/files/neg/t7605-deprecation.check
+++ b/test/files/neg/t7605-deprecation.check
@@ -1,12 +1,15 @@
-t7605-deprecation.scala:2: warning: Procedure syntax is deprecated. Convert procedure to method by adding `: Unit =`.
- def this(i: Int) { this() }
- ^
-t7605-deprecation.scala:3: warning: Procedure syntax is deprecated. Convert procedure to method by adding `: Unit =`.
+t7605-deprecation.scala:2: warning: Procedure syntax is deprecated. Convert procedure `bar` to method by adding `: Unit =`.
def bar {}
^
-t7605-deprecation.scala:4: warning: Procedure syntax is deprecated. Convert procedure to method by adding `: Unit`.
+t7605-deprecation.scala:3: warning: Procedure syntax is deprecated. Convert procedure `baz` to method by adding `: Unit`.
def baz
^
+t7605-deprecation.scala:4: warning: Procedure syntax is deprecated. Convert procedure `boo` to method by adding `: Unit`.
+ def boo(i: Int, l: Long)
+ ^
+t7605-deprecation.scala:5: warning: Procedure syntax is deprecated. Convert procedure `boz` to method by adding `: Unit =`.
+ def boz(i: Int, l: Long) {}
+ ^
error: No warnings can be incurred under -Xfatal-warnings.
-three warnings found
+four warnings found
one error found
diff --git a/test/files/neg/t7605-deprecation.scala b/test/files/neg/t7605-deprecation.scala
index 4a7dcd26d6..2b3362f94a 100644
--- a/test/files/neg/t7605-deprecation.scala
+++ b/test/files/neg/t7605-deprecation.scala
@@ -1,5 +1,8 @@
abstract class Foo {
- def this(i: Int) { this() }
def bar {}
def baz
-} \ No newline at end of file
+ def boo(i: Int, l: Long)
+ def boz(i: Int, l: Long) {}
+ def this(i: Int) { this() } // Don't complain here!
+ def foz: Unit // Don't complain here!
+}
diff --git a/test/files/neg/t997.scala b/test/files/neg/t997.scala
index e8d10f4317..1198738f24 100644
--- a/test/files/neg/t997.scala
+++ b/test/files/neg/t997.scala
@@ -1,5 +1,5 @@
// An extractor with 2 results
-object Foo { def unapply(x : String) = Some(Pair(x, x)) }
+object Foo { def unapply(x : String) = Some((x, x)) }
object Test extends App {
diff --git a/test/files/neg/wellkinded_wrongarity.check b/test/files/neg/wellkinded_wrongarity.check
index 1dc38db5c1..b9f033b453 100644
--- a/test/files/neg/wellkinded_wrongarity.check
+++ b/test/files/neg/wellkinded_wrongarity.check
@@ -1,4 +1,4 @@
-wellkinded_wrongarity.scala:5: error: Pair takes two type parameters, expected: one
-object mp extends Monad[Pair]
+wellkinded_wrongarity.scala:5: error: Tuple2 takes two type parameters, expected: one
+object mp extends Monad[Tuple2]
^
one error found
diff --git a/test/files/neg/wellkinded_wrongarity.scala b/test/files/neg/wellkinded_wrongarity.scala
index 2bb0e2ce8a..39c7601d53 100644
--- a/test/files/neg/wellkinded_wrongarity.scala
+++ b/test/files/neg/wellkinded_wrongarity.scala
@@ -2,4 +2,4 @@
class Monad[m[x]]
-object mp extends Monad[Pair]
+object mp extends Monad[Tuple2]
diff --git a/test/files/pos/bounds.scala b/test/files/pos/bounds.scala
index cfea4626c3..26bc84a1b9 100644
--- a/test/files/pos/bounds.scala
+++ b/test/files/pos/bounds.scala
@@ -1,11 +1,11 @@
trait Map[A, +C] {
- def ++ [B1 >: C] (kvs: Iterable[Pair[A, B1]]): Map[A, B1] = this
- def ++ [B1 >: C] (kvs: Iterator[Pair[A, B1]]): Map[A, B1] = this
+ def ++ [B1 >: C] (kvs: Iterable[Tuple2[A, B1]]): Map[A, B1] = this
+ def ++ [B1 >: C] (kvs: Iterator[Tuple2[A, B1]]): Map[A, B1] = this
}
class ListMap[A, +B] extends Map[A, B] {}
object ListMap {
def empty[X, Y] = new ListMap[X, Y]
- def apply[A1, B2](elems: Pair[A1, B2]*): Map[A1, B2] = empty[A1,B2].++(elems.iterator)
+ def apply[A1, B2](elems: Tuple2[A1, B2]*): Map[A1, B2] = empty[A1,B2].++(elems.iterator)
}
diff --git a/test/files/pos/patmat.scala b/test/files/pos/patmat.scala
index 4e652b146e..51b879abf2 100644
--- a/test/files/pos/patmat.scala
+++ b/test/files/pos/patmat.scala
@@ -3,8 +3,8 @@
object ZipFun {
//just compilation
- def zipFun[a, b](xs: List[a], ys: List[b]): List[Pair[a, b]] = (Pair(xs, ys): @unchecked) match {
- // !!! case Pair(List(), _), Pair(_, List()) => List()
+ def zipFun[a, b](xs: List[a], ys: List[b]): List[Tuple2[a, b]] = ((xs, ys): @unchecked) match {
+ // !!! case (List(), _), (_, List()) => List()
case (x :: xs1, y :: ys1) => (x, y) :: zipFun(xs1, ys1)
}
}
diff --git a/test/files/pos/spec-doubledef-new.scala b/test/files/pos/spec-doubledef-new.scala
index ad9c6399a5..589ceb33b2 100644
--- a/test/files/pos/spec-doubledef-new.scala
+++ b/test/files/pos/spec-doubledef-new.scala
@@ -19,12 +19,12 @@ abstract class B[T, @specialized(scala.Int) U : TypeTag, @specialized(scala.Int)
val u: U
val v: V
- def f(t: T, v2: V): Pair[U, V] = {
+ def f(t: T, v2: V): Tuple2[U, V] = {
val m: Array[U] = null
if (m.isEmpty) {
- Pair(u, v)
+ (u, v)
} else {
- Pair(u, v2)
+ (u, v2)
}
}
} \ No newline at end of file
diff --git a/test/files/pos/spec-doubledef-old.scala b/test/files/pos/spec-doubledef-old.scala
index 86b0d857d3..bde259e4fa 100644
--- a/test/files/pos/spec-doubledef-old.scala
+++ b/test/files/pos/spec-doubledef-old.scala
@@ -17,12 +17,12 @@ abstract class B[T, @specialized(scala.Int) U : Manifest, @specialized(scala.Int
val u: U
val v: V
- def f(t: T, v2: V): Pair[U, V] = {
+ def f(t: T, v2: V): Tuple2[U, V] = {
val m: Array[U] = null
if (m.isEmpty) {
- Pair(u, v)
+ (u, v)
} else {
- Pair(u, v2)
+ (u, v2)
}
}
}
diff --git a/test/files/pos/t0064.scala b/test/files/pos/t0064.scala
index c2ce4bf6d0..1eeca8dcad 100644
--- a/test/files/pos/t0064.scala
+++ b/test/files/pos/t0064.scala
@@ -1,6 +1,6 @@
object B {
def main(Args:Array[String]) = {
- val Pair(_,x) = Pair(1,2);
+ val (_,x) = (1,2);
x + 1;
}
}
diff --git a/test/files/pos/t1014.scala b/test/files/pos/t1014.scala
new file mode 100644
index 0000000000..6fb7f7ba49
--- /dev/null
+++ b/test/files/pos/t1014.scala
@@ -0,0 +1,16 @@
+class NodeSeq
+class Elem extends NodeSeq
+
+class EO extends App with Moo {
+ // return type is Flog, inherited from overridden method.
+ // implicit conversions are applied because expected type `pt` is `Flog` when `computeType(rhs, pt)`.
+ def cat = (??? : Elem)
+
+ implicit def nodeSeqToFlog(in: Elem): Flog = new Flog(in)
+}
+
+trait Moo {
+ def cat: Flog
+}
+
+class Flog(val in: NodeSeq)
diff --git a/test/files/pos/t1203a.scala b/test/files/pos/t1203a.scala
new file mode 100644
index 0000000000..cf5ab9fba0
--- /dev/null
+++ b/test/files/pos/t1203a.scala
@@ -0,0 +1,13 @@
+class Node
+object NodeSeq {
+ implicit def seqToNodeSeq(s: Seq[Node]): NodeSeq = ???
+}
+abstract class NodeSeq extends collection.immutable.Seq[Node]
+
+case class ant(t: String) extends scala.annotation.Annotation
+object Test {
+ def main(args: Array[String]): Unit = {
+ val a: NodeSeq @ant("12") = Nil
+ println(a)
+ }
+}
diff --git a/test/files/pos/t247.scala b/test/files/pos/t247.scala
index e976404e61..fdcafeb2c6 100644
--- a/test/files/pos/t247.scala
+++ b/test/files/pos/t247.scala
@@ -16,11 +16,11 @@ class Tree[KEY,Entry](order:Order[KEY]) {
def size =0;
}
-class TreeMap[KEY,VALUE](_factory:TreeMapFactory[KEY]) extends Tree[KEY,Pair[KEY,VALUE]](_factory.order) with scala.collection.DefaultMap[KEY, VALUE] with Map[KEY, VALUE] {
+class TreeMap[KEY,VALUE](_factory:TreeMapFactory[KEY]) extends Tree[KEY,Tuple2[KEY,VALUE]](_factory.order) with scala.collection.DefaultMap[KEY, VALUE] with Map[KEY, VALUE] {
val factory = _factory
val order = _factory.order;
def this(newOrder:Order[KEY]) = this(new TreeMapFactory[KEY](newOrder));
def get(key:KEY) = null;
- def iterator:Iterator[Pair[KEY,VALUE]] = null;
+ def iterator:Iterator[Tuple2[KEY,VALUE]] = null;
override def size = super[Tree].size
}
diff --git a/test/files/pos/t2698.scala b/test/files/pos/t2698.scala
new file mode 100644
index 0000000000..bce02e48b3
--- /dev/null
+++ b/test/files/pos/t2698.scala
@@ -0,0 +1,14 @@
+class WordExp {
+ abstract class Label
+ type _labelT <: Label
+}
+
+import scala.collection._
+
+abstract class S2 {
+ val lang: WordExp
+ type __labelT = lang._labelT
+
+ var deltaq: Array[__labelT] = _
+ def delta1 = immutable.Map(deltaq.zipWithIndex: _*)
+}
diff --git a/test/files/pos/t3160.scala b/test/files/pos/t3160.scala
new file mode 100644
index 0000000000..cc007dc014
--- /dev/null
+++ b/test/files/pos/t3160.scala
@@ -0,0 +1,6 @@
+import scala.collection.mutable._
+class Node
+
+class A {
+ def f(x: Node): Node = ???
+}
diff --git a/test/files/pos/t443.scala b/test/files/pos/t443.scala
index 5b5e3ea828..cdaefe9ecd 100644
--- a/test/files/pos/t443.scala
+++ b/test/files/pos/t443.scala
@@ -1,10 +1,10 @@
object Test {
- def lookup(): Option[Pair[String, String]] =
- ((null: Option[Pair[String, String]]) : @unchecked) match {
- case Some(Pair(_, _)) =>
+ def lookup(): Option[Tuple2[String, String]] =
+ ((null: Option[Tuple2[String, String]]) : @unchecked) match {
+ case Some((_, _)) =>
if (true)
- Some(Pair(null, null))
+ Some((null, null))
else
lookup() match {
case Some(_) => Some(null)
diff --git a/test/files/pos/t4579.scala b/test/files/pos/t4579.scala
index 8951ec011f..cd1553f02a 100644
--- a/test/files/pos/t4579.scala
+++ b/test/files/pos/t4579.scala
@@ -190,10 +190,10 @@ object LispCaseClasses extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
@@ -381,10 +381,10 @@ object LispAny extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
diff --git a/test/files/pos/t5120.scala b/test/files/pos/t5120.scala
index 6731af14e4..86d4470bd5 100644
--- a/test/files/pos/t5120.scala
+++ b/test/files/pos/t5120.scala
@@ -5,9 +5,9 @@ class Test {
class ScopedKey[T]
class Value[T]
- class Compiled[T](val settings: Seq[Pair[T]])
+ class Compiled[T](val settings: Seq[Tuple2[T]])
- case class Pair[T](k: ScopedKey[T], v: ScopedKey[T])
+ case class Tuple2[T](k: ScopedKey[T], v: ScopedKey[T])
def transform[T](x: T) = x
diff --git a/test/files/pos/t6201.scala b/test/files/pos/t6201.scala
new file mode 100644
index 0000000000..d4e5bce03a
--- /dev/null
+++ b/test/files/pos/t6201.scala
@@ -0,0 +1,19 @@
+// probably needs xml's weirdness to reproduce
+// (specifically, _root_.scala.xml.Null being in the root package)
+class Elem
+
+class Test {
+ def elem: Elem = ???
+
+ class Foo1 {
+ def must(x: Elem) = ()
+ }
+
+ class Foo2 {
+ def must(x: Int) = ()
+ }
+ implicit def toFoo1(s: Elem) = new Foo1()
+ implicit def toFoo2(s: Elem) = new Foo2()
+
+ def is: Unit = { (elem) }
+} \ No newline at end of file
diff --git a/test/files/pos/t7987/Macro_1.scala b/test/files/pos/t7987/Macro_1.scala
new file mode 100644
index 0000000000..81f717b9c4
--- /dev/null
+++ b/test/files/pos/t7987/Macro_1.scala
@@ -0,0 +1,6 @@
+import scala.language.experimental._
+
+object Macro {
+ def apply[A](a: A): A = macro impl[A]
+ def impl[A](c: reflect.macros.Context)(a: c.Expr[A]): c.Expr[A] = a
+}
diff --git a/test/files/pos/t7987/Test_2.scala b/test/files/pos/t7987/Test_2.scala
new file mode 100644
index 0000000000..5896fdb517
--- /dev/null
+++ b/test/files/pos/t7987/Test_2.scala
@@ -0,0 +1,12 @@
+class C[T] {
+ def foo = 0
+}
+
+object Test {
+ implicit def AnyToC[T](a: Any): C[T] = new C[T]
+ // was: "macro not expanded"
+ Macro {
+ "".foo
+ ()
+ }
+}
diff --git a/test/files/pos/tcpoly_bounds1.scala b/test/files/pos/tcpoly_bounds1.scala
index 5874cc664d..63263cb152 100644
--- a/test/files/pos/tcpoly_bounds1.scala
+++ b/test/files/pos/tcpoly_bounds1.scala
@@ -1,7 +1,7 @@
-class Foo[t[x]<: Pair[Int, x]]
+class Foo[t[x]<: Tuple2[Int, x]]
//
-class MyPair[z](a: Int, b: z) extends Pair[Int, z](a,b)
+class MyPair[z](a: Int, b: z) extends Tuple2[Int, z](a,b)
object foo extends Foo[MyPair]
diff --git a/test/files/pos/typealiases.scala b/test/files/pos/typealiases.scala
index d03b521f77..93d1dce4dc 100644
--- a/test/files/pos/typealiases.scala
+++ b/test/files/pos/typealiases.scala
@@ -14,7 +14,7 @@ trait Test[T] {
object main extends Test[Int] {
val pair1 = (1,1)
- implicit def topair(x: Int): Pair[Int, Int] = (x,x)
+ implicit def topair(x: Int): Tuple2[Int, Int] = (x,x)
val pair2: MyPair[Int] = 1
val x: Short = 1
}
diff --git a/test/files/pos/unapplyNeedsMemberType.scala b/test/files/pos/unapplyNeedsMemberType.scala
index b423257e04..3a96e189af 100644
--- a/test/files/pos/unapplyNeedsMemberType.scala
+++ b/test/files/pos/unapplyNeedsMemberType.scala
@@ -19,7 +19,7 @@ class Join[a] extends Gunk[a] {
def append(s1: Seq, s2: Seq): Seq = s1 // mock implementation
def unapply_Cons(s: Any) = s match {
- case App(Cons(x, xs), ys) => Some(Pair(x, append(xs, ys)))
+ case App(Cons(x, xs), ys) => Some((x, append(xs, ys)))
case _ => null
}
}
diff --git a/test/files/pos/valdefs.scala b/test/files/pos/valdefs.scala
index 85ffa132b7..c8f78cd2bf 100644
--- a/test/files/pos/valdefs.scala
+++ b/test/files/pos/valdefs.scala
@@ -11,6 +11,6 @@ object test {
}
abstract class Sub2() extends Base() {
- override val Pair(x, y) = Pair("abc", 2.0);
+ override val (x, y) = ("abc", 2.0);
}
}
diff --git a/test/files/positions/ExcludedPrefix1.scala b/test/files/positions/ExcludedPrefix1.scala
index f3562c37f0..b3182eae78 100644
--- a/test/files/positions/ExcludedPrefix1.scala
+++ b/test/files/positions/ExcludedPrefix1.scala
@@ -35,7 +35,7 @@ object ExcludedPrefix1 {
(i,
j) = (0, 0)
- val Pair(
+ val (
k,
l) = (0, 0)
}
diff --git a/test/files/positions/Overlap4.scala b/test/files/positions/Overlap4.scala
index 0049293954..f54837295b 100644
--- a/test/files/positions/Overlap4.scala
+++ b/test/files/positions/Overlap4.scala
@@ -1,3 +1,3 @@
object Overlap4 {
- val Pair(a, b) = (0, 0)
+ val (a, b) = (0, 0)
}
diff --git a/test/files/positions/Scaladoc7.scala b/test/files/positions/Scaladoc7.scala
index 6175222e3f..0198d4d6ac 100644
--- a/test/files/positions/Scaladoc7.scala
+++ b/test/files/positions/Scaladoc7.scala
@@ -2,5 +2,5 @@ object Scaladoc7 {
/**
* Foo
*/
- val Pair(i, j) = (1, 2)
+ val (i, j) = (1, 2)
}
diff --git a/test/files/presentation/callcc-interpreter.check b/test/files/presentation/callcc-interpreter.check
index d41b982614..1f868097ca 100644
--- a/test/files/presentation/callcc-interpreter.check
+++ b/test/files/presentation/callcc-interpreter.check
@@ -1,8 +1,8 @@
reload: CallccInterpreter.scala
-askTypeCompletion at CallccInterpreter.scala(51,38)
+askTypeCompletion at CallccInterpreter.scala(51,34)
================================================================================
-[response] askCompletionAt (51,38)
+[response] askTypeCompletion at (51,34)
retrieved 59 members
abstract trait Term extends AnyRef
abstract trait Value extends AnyRef
@@ -83,8 +83,8 @@ def showM(m: callccInterpreter.M[callccInterpreter.Value]): String = m.in.apply(
askType at CallccInterpreter.scala(50,30)
================================================================================
[response] askTypeAt (50,30)
-def add(a: callccInterpreter.Value, b: callccInterpreter.Value): callccInterpreter.M[_ >: callccInterpreter.Num with callccInterpreter.Wrong.type <: Product with Serializable with callccInterpreter.Value] = scala.this.Predef.Pair.apply[callccInterpreter.Value, callccInterpreter.Value](a, b) match {
- case scala.this.Predef.Pair.unapply[callccInterpreter.Value, callccInterpreter.Value](<unapply-selector>) <unapply> ((n: Int)callccInterpreter.Num((m @ _)), (n: Int)callccInterpreter.Num((n @ _))) => this.unitM[callccInterpreter.Num](callccInterpreter.this.Num.apply(m.+(n)))
+def add(a: callccInterpreter.Value, b: callccInterpreter.Value): callccInterpreter.M[_ >: callccInterpreter.Num with callccInterpreter.Wrong.type <: Product with Serializable with callccInterpreter.Value] = scala.Tuple2.apply[callccInterpreter.Value, callccInterpreter.Value](a, b) match {
+ case (_1: callccInterpreter.Value, _2: callccInterpreter.Value)(callccInterpreter.Value, callccInterpreter.Value)((n: Int)callccInterpreter.Num((m @ _)), (n: Int)callccInterpreter.Num((n @ _))) => this.unitM[callccInterpreter.Num](callccInterpreter.this.Num.apply(m.+(n)))
case _ => callccInterpreter.this.unitM[callccInterpreter.Wrong.type](callccInterpreter.this.Wrong)
}
================================================================================
diff --git a/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala b/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala
index ce3b996b96..d498fe0b17 100644
--- a/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala
+++ b/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala
@@ -40,15 +40,15 @@ object callccInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]]
+ type Environment = List[Tuple2[Name, Value]]
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value) /*?*/ = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => this./*!*/unitM(Num(m + n))
+ def add(a: Value, b: Value) /*?*/ = (a, b) match {
+ case (Num(m), Num(n)) => this./*!*/unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -60,16 +60,20 @@ object callccInterpreter {
def interp(t: Term, e: Environment): M[Value] = t match {
case Var(x) => lookup(x, e)
case Con(n) => unitM(Num(n))
- case Add(l, r) => for (val a <- interp(l, e);
- val b <- interp(r, e);
- val c <- add(a, b))
- yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
- case App(f, t) => for (val a <- interp(f, e);
- val b <- interp(t, e);
- val c <- apply(a, b))
- yield c
- case Ccc(x, t) => callCC(k => interp(t, Pair(x, Fun(k)) :: e))
+ case Add(l, r) =>
+ for {
+ a <- interp(l, e)
+ b <- interp(r, e)
+ c <- add(a, b)
+ } yield c
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
+ case App(f, t) =>
+ for {
+ a <- interp(f, e)
+ b <- interp(t, e)
+ c <- apply(a, b)
+ } yield c
+ case Ccc(x, t) => callCC(k => interp(t, (x, Fun(k)) :: e))
}
def test(t: Term): String = showM(interp(t, List()))
diff --git a/test/files/presentation/completion-implicit-chained.check b/test/files/presentation/completion-implicit-chained.check
index b34e6bc7e1..f9d77f7a53 100644
--- a/test/files/presentation/completion-implicit-chained.check
+++ b/test/files/presentation/completion-implicit-chained.check
@@ -2,7 +2,7 @@ reload: Completions.scala
askTypeCompletion at Completions.scala(11,16)
================================================================================
-[response] askCompletionAt (11,16)
+[response] askTypeCompletion at (11,16)
retrieved 24 members
[inaccessible] protected[package lang] def clone(): Object
[inaccessible] protected[package lang] def finalize(): Unit
diff --git a/test/files/presentation/ide-bug-1000349.check b/test/files/presentation/ide-bug-1000349.check
index aa6660cec5..c59fa6843f 100644
--- a/test/files/presentation/ide-bug-1000349.check
+++ b/test/files/presentation/ide-bug-1000349.check
@@ -2,7 +2,7 @@ reload: CompletionOnEmptyArgMethod.scala
askTypeCompletion at CompletionOnEmptyArgMethod.scala(2,17)
================================================================================
-[response] askCompletionAt (2,17)
+[response] askTypeCompletion at (2,17)
retrieved 32 members
def +(other: String): String
def ->[B](y: B): (Foo, B)
diff --git a/test/files/presentation/ide-bug-1000475.check b/test/files/presentation/ide-bug-1000475.check
index cb7de6d34a..f5b4253e1a 100644
--- a/test/files/presentation/ide-bug-1000475.check
+++ b/test/files/presentation/ide-bug-1000475.check
@@ -2,7 +2,7 @@ reload: Foo.scala
askTypeCompletion at Foo.scala(3,7)
================================================================================
-[response] askCompletionAt (3,7)
+[response] askTypeCompletion at (3,7)
retrieved 31 members
[inaccessible] protected[package lang] def clone(): Object
[inaccessible] protected[package lang] def finalize(): Unit
@@ -36,7 +36,7 @@ final def wait(x$1: Long,x$2: Int): Unit
askTypeCompletion at Foo.scala(6,10)
================================================================================
-[response] askCompletionAt (6,10)
+[response] askTypeCompletion at (6,10)
retrieved 31 members
[inaccessible] protected[package lang] def clone(): Object
[inaccessible] protected[package lang] def finalize(): Unit
@@ -70,7 +70,7 @@ final def wait(x$1: Long,x$2: Int): Unit
askTypeCompletion at Foo.scala(7,7)
================================================================================
-[response] askCompletionAt (7,7)
+[response] askTypeCompletion at (7,7)
retrieved 31 members
[inaccessible] protected[package lang] def clone(): Object
[inaccessible] protected[package lang] def finalize(): Unit
diff --git a/test/files/presentation/ide-bug-1000531.check b/test/files/presentation/ide-bug-1000531.check
index 9a2cad5fd2..dff89b155b 100644
--- a/test/files/presentation/ide-bug-1000531.check
+++ b/test/files/presentation/ide-bug-1000531.check
@@ -2,7 +2,7 @@ reload: CrashOnLoad.scala
askTypeCompletion at CrashOnLoad.scala(6,12)
================================================================================
-[response] askCompletionAt (6,12)
+[response] askTypeCompletion at (6,12)
retrieved 120 members
[inaccessible] protected[package lang] def clone(): Object
[inaccessible] protected[package lang] def finalize(): Unit
diff --git a/test/files/presentation/implicit-member.check b/test/files/presentation/implicit-member.check
index ef361599c5..5ad52b4dd3 100644
--- a/test/files/presentation/implicit-member.check
+++ b/test/files/presentation/implicit-member.check
@@ -2,7 +2,7 @@ reload: ImplicitMember.scala
askTypeCompletion at ImplicitMember.scala(7,7)
================================================================================
-[response] askCompletionAt (7,7)
+[response] askTypeCompletion at (7,7)
retrieved 34 members
def +(other: String): String
def ->[B](y: B): (Implicit.type, B)
diff --git a/test/files/presentation/ping-pong.check b/test/files/presentation/ping-pong.check
index 10d29bfed6..20f17aa7d0 100644
--- a/test/files/presentation/ping-pong.check
+++ b/test/files/presentation/ping-pong.check
@@ -2,7 +2,7 @@ reload: PingPong.scala
askTypeCompletion at PingPong.scala(10,23)
================================================================================
-[response] askCompletionAt (10,23)
+[response] askTypeCompletion at (10,23)
retrieved 35 members
[inaccessible] private[this] val ping: Ping
[inaccessible] protected[package lang] def clone(): Object
@@ -39,7 +39,7 @@ private[this] val name: String
askTypeCompletion at PingPong.scala(19,20)
================================================================================
-[response] askCompletionAt (19,20)
+[response] askTypeCompletion at (19,20)
retrieved 35 members
[inaccessible] protected[package lang] def clone(): Object
[inaccessible] protected[package lang] def finalize(): Unit
diff --git a/test/files/presentation/scope-completion-1.check b/test/files/presentation/scope-completion-1.check
new file mode 100644
index 0000000000..63f956b239
--- /dev/null
+++ b/test/files/presentation/scope-completion-1.check
@@ -0,0 +1,19 @@
+reload: Completions.scala
+
+askScopeCompletion at Completions.scala(6,2)
+================================================================================
+[response] askScopeCompletion at (6,2)
+retrieved 3 members
+class Completion1 extends AnyRef
+def <init>(): test.Completion1
+object Completion2
+================================================================================
+
+askScopeCompletion at Completions.scala(10,2)
+================================================================================
+[response] askScopeCompletion at (10,2)
+retrieved 3 members
+class Completion1 extends AnyRef
+def <init>(): test.Completion2.type
+object Completion2
+================================================================================
diff --git a/test/files/presentation/scope-completion-1/Test.scala b/test/files/presentation/scope-completion-1/Test.scala
new file mode 100644
index 0000000000..bec1131c4c
--- /dev/null
+++ b/test/files/presentation/scope-completion-1/Test.scala
@@ -0,0 +1,3 @@
+import scala.tools.nsc.interactive.tests.InteractiveTest
+
+object Test extends InteractiveTest \ No newline at end of file
diff --git a/test/files/presentation/scope-completion-1/src/Completions.scala b/test/files/presentation/scope-completion-1/src/Completions.scala
new file mode 100644
index 0000000000..c4eea6b261
--- /dev/null
+++ b/test/files/presentation/scope-completion-1/src/Completions.scala
@@ -0,0 +1,12 @@
+package test
+
+/* completion on empty class and object */
+
+class Completion1 {
+ /*_*/
+}
+
+object Completion2 {
+ /*_*/
+}
+
diff --git a/test/files/presentation/scope-completion-2.check b/test/files/presentation/scope-completion-2.check
new file mode 100644
index 0000000000..3a1dbd7cff
--- /dev/null
+++ b/test/files/presentation/scope-completion-2.check
@@ -0,0 +1,35 @@
+reload: Completions.scala
+
+askScopeCompletion at Completions.scala(16,4)
+================================================================================
+[response] askScopeCompletion at (16,4)
+retrieved 11 members
+class Completion1 extends AnyRef
+def <init>(): test.Completion1
+def test: Unit
+object Completion1
+private class Cc1 extends AnyRef
+private class Co1 extends AnyRef
+private def fc1: Int
+private def fo1: Int
+private[this] val c: test.Completion1
+private[this] val vc1: Int
+private[this] val vo1: Int
+================================================================================
+
+askScopeCompletion at Completions.scala(32,4)
+================================================================================
+[response] askScopeCompletion at (32,4)
+retrieved 11 members
+[inaccessible] private[this] val vc1: Int
+class Completion1 extends AnyRef
+def <init>(): test.Completion1.type
+def test: Unit
+object Completion1
+private class Cc1 extends AnyRef
+private class Co1 extends AnyRef
+private def fc1: Int
+private def fo1: Int
+private[this] val c: test.Completion1
+private[this] val vo1: Int
+================================================================================
diff --git a/test/files/presentation/scope-completion-2/Test.scala b/test/files/presentation/scope-completion-2/Test.scala
new file mode 100644
index 0000000000..bec1131c4c
--- /dev/null
+++ b/test/files/presentation/scope-completion-2/Test.scala
@@ -0,0 +1,3 @@
+import scala.tools.nsc.interactive.tests.InteractiveTest
+
+object Test extends InteractiveTest \ No newline at end of file
diff --git a/test/files/presentation/scope-completion-2/src/Completions.scala b/test/files/presentation/scope-completion-2/src/Completions.scala
new file mode 100644
index 0000000000..96d38f1b85
--- /dev/null
+++ b/test/files/presentation/scope-completion-2/src/Completions.scala
@@ -0,0 +1,35 @@
+package test
+
+/* private elements are visible in the companion class/object */
+
+class Completion1 {
+
+ import Completion1._
+
+ private val vc1 = 0
+ private def fc1 = 0
+
+ private class Cc1
+
+ def test {
+ // needs to be done in a method, because of SI-7280
+ /*_*/
+ }
+}
+
+object Completion1 {
+
+ val c = new Completion1()
+ import c._
+
+ private val vo1 = 0
+ private def fo1 = 0
+
+ private class Co1
+
+ def test {
+ // needs to be done in a method, because of SI-7280
+ /*_*/
+ }
+}
+
diff --git a/test/files/presentation/scope-completion-3.check b/test/files/presentation/scope-completion-3.check
new file mode 100644
index 0000000000..cf73e89a3b
--- /dev/null
+++ b/test/files/presentation/scope-completion-3.check
@@ -0,0 +1,111 @@
+reload: Completions.scala
+
+askScopeCompletion at Completions.scala(75,2)
+================================================================================
+[response] askScopeCompletion at (75,2)
+retrieved 49 members
+[inaccessible] private class Cb2 extends AnyRef
+[inaccessible] private class Ct2 extends AnyRef
+[inaccessible] private def fb2: Int
+[inaccessible] private def ft2: Int
+[inaccessible] private object Ob2
+[inaccessible] private object Ot2
+[inaccessible] private type tb2 = Completion1.this.tb2
+[inaccessible] private type tt2 = Completion1.this.tt2
+[inaccessible] private[this] val vb1: Int
+[inaccessible] private[this] val vb2: Int
+[inaccessible] private[this] val vt1: Int
+[inaccessible] private[this] val vt2: Int
+[inaccessible] private[this] var rb1: Int
+[inaccessible] private[this] var rb2: Int
+[inaccessible] private[this] var rt1: Int
+[inaccessible] private[this] var rt2: Int
+abstract class Base1 extends AnyRef
+abstract trait Trait1 extends AnyRef
+class Cb1 extends AnyRef
+class Cc1 extends AnyRef
+class Completion1 extends Base1 with Trait1
+class Ct1 extends AnyRef
+def <init>(): test.Completion1
+def fb1: Int
+def fc1: Int
+def ft1: Int
+object Completion2
+object Ob1
+object Oc1
+object Ot1
+override def fb3: Int
+override def ft3: Int
+override type tb3 = Completion1.this.tb3
+override type tt3 = Completion1.this.tt3
+private class Cc2 extends AnyRef
+private def fc2: Int
+private object Oc2
+private type tc2 = Completion1.this.tc2
+private[this] val vb3: Int
+private[this] val vc1: Int
+private[this] val vc2: Int
+private[this] val vt3: Int
+private[this] var rb3: Int
+private[this] var rc1: Int
+private[this] var rc2: Int
+private[this] var rt3: Int
+type tb1 = Completion1.this.tb1
+type tc1 = Completion1.this.tc1
+type tt1 = Completion1.this.tt1
+================================================================================
+
+askScopeCompletion at Completions.scala(104,2)
+================================================================================
+[response] askScopeCompletion at (104,2)
+retrieved 49 members
+[inaccessible] private class Cb2 extends AnyRef
+[inaccessible] private class Ct2 extends AnyRef
+[inaccessible] private def fb2: Int
+[inaccessible] private def ft2: Int
+[inaccessible] private object Ob2
+[inaccessible] private object Ot2
+[inaccessible] private type tb2 = test.Completion2.tb2
+[inaccessible] private type tt2 = test.Completion2.tt2
+[inaccessible] private[this] val vb1: Int
+[inaccessible] private[this] val vb2: Int
+[inaccessible] private[this] val vt1: Int
+[inaccessible] private[this] val vt2: Int
+[inaccessible] private[this] var rb1: Int
+[inaccessible] private[this] var rb2: Int
+[inaccessible] private[this] var rt1: Int
+[inaccessible] private[this] var rt2: Int
+abstract class Base1 extends AnyRef
+abstract trait Trait1 extends AnyRef
+class Cb1 extends AnyRef
+class Co1 extends AnyRef
+class Completion1 extends Base1 with Trait1
+class Ct1 extends AnyRef
+def <init>(): test.Completion2.type
+def fb1: Int
+def fo1: Int
+def ft1: Int
+object Completion2
+object Ob1
+object Oo1
+object Ot1
+override def fb3: Int
+override def ft3: Int
+override type tb3 = test.Completion2.tb3
+override type tt3 = test.Completion2.tt3
+private class Co2 extends AnyRef
+private def fo2: Int
+private object Oo2
+private type to2 = test.Completion2.to2
+private[this] val vb3: Int
+private[this] val vo1: Int
+private[this] val vo2: Int
+private[this] val vt3: Int
+private[this] var rb3: Int
+private[this] var ro1: Int
+private[this] var ro2: Int
+private[this] var rt3: Int
+type tb1 = test.Completion2.tb1
+type to1 = test.Completion2.to1
+type tt1 = test.Completion2.tt1
+================================================================================
diff --git a/test/files/presentation/scope-completion-3/Test.scala b/test/files/presentation/scope-completion-3/Test.scala
new file mode 100644
index 0000000000..bec1131c4c
--- /dev/null
+++ b/test/files/presentation/scope-completion-3/Test.scala
@@ -0,0 +1,3 @@
+import scala.tools.nsc.interactive.tests.InteractiveTest
+
+object Test extends InteractiveTest \ No newline at end of file
diff --git a/test/files/presentation/scope-completion-3/src/Completions.scala b/test/files/presentation/scope-completion-3/src/Completions.scala
new file mode 100644
index 0000000000..18cef1cefa
--- /dev/null
+++ b/test/files/presentation/scope-completion-3/src/Completions.scala
@@ -0,0 +1,106 @@
+package test
+
+/* check availability of members defined locally and in hierachy */
+
+abstract class Base1 {
+
+ type tb1 = Int
+ val vb1 = 0
+ var rb1 = 0
+ def fb1 = 0
+ class Cb1
+ object Ob1
+
+ private type tb2 = Int
+ private val vb2 = 0
+ private var rb2 = 0
+ private def fb2 = 0
+ private class Cb2
+ private object Ob2
+
+ type tb3
+ val vb3: Int
+ var rb3: Int
+ def fb3: Int
+}
+
+trait Trait1 {
+
+ type tt1 = Int
+ val vt1 = 0
+ var rt1 = 0
+ def ft1 = 0
+ class Ct1
+ object Ot1
+
+ private type tt2 = Int
+ private val vt2 = 0
+ private var rt2 = 0
+ private def ft2 = 0
+ private class Ct2
+ private object Ot2
+
+ type tt3
+ val vt3: Int
+ var rt3: Int
+ def ft3: Int
+}
+
+class Completion1 extends Base1 with Trait1 {
+
+ type tc1 = Int
+ val vc1 = 0
+ var rc1 = 0
+ def fc1 = 0
+ class Cc1
+ object Oc1
+
+ private type tc2 = Int
+ private val vc2 = 0
+ private var rc2 = 0
+ private def fc2 = 0
+ private class Cc2
+ private object Oc2
+
+ override type tb3 = Int
+ override val vb3 = 12
+ override var rb3 = 12
+ override def fb3 = 12
+
+ override type tt3 = Int
+ override val vt3 = 12
+ override var rt3 = 12
+ override def ft3 = 12
+
+ /*_*/
+}
+
+object Completion2 extends Base1 with Trait1 {
+
+ type to1 = Int
+ val vo1 = 0
+ var ro1 = 0
+ def fo1 = 0
+ class Co1
+ object Oo1
+
+ private type to2 = Int
+ private val vo2 = 0
+ private var ro2 = 0
+ private def fo2 = 0
+ private class Co2
+ private object Oo2
+
+ override type tb3 = Int
+ override val vb3 = 12
+ override var rb3 = 12
+ override def fb3 = 12
+
+ override type tt3 = Int
+ override val vt3 = 12
+ override var rt3 = 12
+ override def ft3 = 12
+
+ /*_*/
+}
+
diff --git a/test/files/presentation/scope-completion-4.check b/test/files/presentation/scope-completion-4.check
new file mode 100644
index 0000000000..59c47464c4
--- /dev/null
+++ b/test/files/presentation/scope-completion-4.check
@@ -0,0 +1,293 @@
+reload: Completions.scala
+
+askScopeCompletion at Completions.scala(12,8)
+================================================================================
+[response] askScopeCompletion at (12,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class ffc extends AnyRef
+def <init>(): test.Completion1
+def f: Unit
+def ff: Unit
+def fff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(15,6)
+================================================================================
+[response] askScopeCompletion at (15,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class ffc extends AnyRef
+def <init>(): test.Completion1
+def f: Unit
+def ff: Unit
+def fff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(18,8)
+================================================================================
+[response] askScopeCompletion at (18,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class ffc extends AnyRef
+def <init>(): ffc
+def f: Unit
+def ff: Unit
+def fff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(21,6)
+================================================================================
+[response] askScopeCompletion at (21,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class ffc extends AnyRef
+def <init>(): test.Completion1
+def f: Unit
+def ff: Unit
+def fff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(24,4)
+================================================================================
+[response] askScopeCompletion at (24,4)
+retrieved 6 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+def <init>(): test.Completion1
+def f: Unit
+def ff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(29,8)
+================================================================================
+[response] askScopeCompletion at (29,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class fcc extends AnyRef
+def <init>(): fc
+def f: Unit
+def fcf: Unit
+def ff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(32,6)
+================================================================================
+[response] askScopeCompletion at (32,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class fcc extends AnyRef
+def <init>(): fc
+def f: Unit
+def fcf: Unit
+def ff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(35,8)
+================================================================================
+[response] askScopeCompletion at (35,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class fcc extends AnyRef
+def <init>(): fc.this.fcc
+def f: Unit
+def fcf: Unit
+def ff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(38,6)
+================================================================================
+[response] askScopeCompletion at (38,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+class fcc extends AnyRef
+def <init>(): fc
+def f: Unit
+def fcf: Unit
+def ff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(41,4)
+================================================================================
+[response] askScopeCompletion at (41,4)
+retrieved 6 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class fc extends AnyRef
+def <init>(): test.Completion1
+def f: Unit
+def ff: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(44,2)
+================================================================================
+[response] askScopeCompletion at (44,2)
+retrieved 4 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+def <init>(): test.Completion1
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(51,8)
+================================================================================
+[response] askScopeCompletion at (51,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class ccc extends AnyRef
+def <init>(): cc.this.ccc
+def ccf: Unit
+def cf: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(54,6)
+================================================================================
+[response] askScopeCompletion at (54,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class ccc extends AnyRef
+def <init>(): c.this.cc
+def ccf: Unit
+def cf: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(57,8)
+================================================================================
+[response] askScopeCompletion at (57,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class ccc extends AnyRef
+def <init>(): c.this.cc
+def ccf: Unit
+def cf: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(60,6)
+================================================================================
+[response] askScopeCompletion at (60,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class ccc extends AnyRef
+def <init>(): c.this.cc
+def ccf: Unit
+def cf: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(63,4)
+================================================================================
+[response] askScopeCompletion at (63,4)
+retrieved 6 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+def <init>(): Completion1.this.c
+def cf: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(68,8)
+================================================================================
+[response] askScopeCompletion at (68,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class cfc extends AnyRef
+def <init>(): cfc
+def cf: Unit
+def cff: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(71,6)
+================================================================================
+[response] askScopeCompletion at (71,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class cfc extends AnyRef
+def <init>(): Completion1.this.c
+def cf: Unit
+def cff: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(74,8)
+================================================================================
+[response] askScopeCompletion at (74,8)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class cfc extends AnyRef
+def <init>(): Completion1.this.c
+def cf: Unit
+def cff: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(77,6)
+================================================================================
+[response] askScopeCompletion at (77,6)
+retrieved 8 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+class cfc extends AnyRef
+def <init>(): Completion1.this.c
+def cf: Unit
+def cff: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(80,4)
+================================================================================
+[response] askScopeCompletion at (80,4)
+retrieved 6 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+class cc extends AnyRef
+def <init>(): Completion1.this.c
+def cf: Unit
+def f: Unit
+================================================================================
+
+askScopeCompletion at Completions.scala(83,2)
+================================================================================
+[response] askScopeCompletion at (83,2)
+retrieved 4 members
+class Completion1 extends AnyRef
+class c extends AnyRef
+def <init>(): test.Completion1
+def f: Unit
+================================================================================
diff --git a/test/files/presentation/scope-completion-4/Test.scala b/test/files/presentation/scope-completion-4/Test.scala
new file mode 100644
index 0000000000..bec1131c4c
--- /dev/null
+++ b/test/files/presentation/scope-completion-4/Test.scala
@@ -0,0 +1,3 @@
+import scala.tools.nsc.interactive.tests.InteractiveTest
+
+object Test extends InteractiveTest \ No newline at end of file
diff --git a/test/files/presentation/scope-completion-4/src/Completions.scala b/test/files/presentation/scope-completion-4/src/Completions.scala
new file mode 100644
index 0000000000..d11315720a
--- /dev/null
+++ b/test/files/presentation/scope-completion-4/src/Completions.scala
@@ -0,0 +1,84 @@
+package test
+
+/* check that members defined in sub-block are not visible*/
+
+class Completion1 {
+
+ def f {
+
+ def ff {
+
+ def fff {
+ /*_*/
+ }
+
+ /*_*/
+
+ class ffc {
+ /*_*/
+ }
+
+ /*_*/
+ }
+
+ /*_*/
+
+ class fc {
+
+ def fcf {
+ /*_*/
+ }
+
+ /*_*/
+
+ class fcc {
+ /*_*/
+ }
+
+ /*_*/
+ }
+
+ /*_*/
+ }
+
+ /*_*/
+
+ class c {
+
+ class cc {
+
+ class ccc {
+ /*_*/
+ }
+
+ /*_*/
+
+ def ccf {
+ /*_*/
+ }
+
+ /*_*/
+ }
+
+ /*_*/
+
+ def cf {
+
+ class cfc {
+ /*_*/
+ }
+
+ /*_*/
+
+ def cff {
+ /*_*/
+ }
+
+ /*_*/
+ }
+
+ /*_*/
+ }
+
+ /*_*/
+}
diff --git a/test/files/presentation/scope-completion-import.check b/test/files/presentation/scope-completion-import.check
new file mode 100644
index 0000000000..d518b0c37a
--- /dev/null
+++ b/test/files/presentation/scope-completion-import.check
@@ -0,0 +1,141 @@
+reload: Completions.scala
+
+askScopeCompletion at Completions.scala(15,4)
+================================================================================
+[response] askScopeCompletion at (15,4)
+retrieved 10 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo
+def fCCC: Int
+def fOOO: Int
+object O
+val o: test.O.type
+================================================================================
+
+askScopeCompletion at Completions.scala(19,4)
+================================================================================
+[response] askScopeCompletion at (19,4)
+retrieved 9 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo
+def fCCC: Int
+def fOOO: Int
+object O
+================================================================================
+
+askScopeCompletion at Completions.scala(24,4)
+================================================================================
+[response] askScopeCompletion at (24,4)
+retrieved 9 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo
+def fCCC: Int
+object O
+val c: test.C
+================================================================================
+
+askScopeCompletion at Completions.scala(27,5)
+================================================================================
+[response] askScopeCompletion at (27,5)
+retrieved 8 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo
+object O
+val c: test.C
+================================================================================
+
+askScopeCompletion at Completions.scala(30,5)
+================================================================================
+[response] askScopeCompletion at (30,5)
+retrieved 9 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo
+def fCCC: Int
+object O
+val c: test.C
+================================================================================
+
+askScopeCompletion at Completions.scala(32,5)
+================================================================================
+[response] askScopeCompletion at (32,5)
+retrieved 10 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo
+def fCCC: Int
+def fOOO: Int
+object O
+val c: test.C
+================================================================================
+
+askScopeCompletion at Completions.scala(41,4)
+================================================================================
+[response] askScopeCompletion at (41,4)
+retrieved 10 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo_1
+def bar: Unit
+def fCCC: Int
+def fOOO: Int
+object O
+================================================================================
+
+askScopeCompletion at Completions.scala(51,4)
+================================================================================
+[response] askScopeCompletion at (51,4)
+retrieved 11 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo_2
+def bar: Unit
+def fCCC: Int
+def fOOO: Int
+object O
+private[this] val o: test.O.type
+================================================================================
+
+askScopeCompletion at Completions.scala(61,4)
+================================================================================
+[response] askScopeCompletion at (61,4)
+retrieved 10 members
+class C extends AnyRef
+class Foo extends AnyRef
+class Foo_1 extends AnyRef
+class Foo_2 extends AnyRef
+class Foo_3 extends AnyRef
+def <init>(): test.Foo_3
+def bar: Unit
+def fCCC: Int
+object O
+private[this] val c: test.C
+================================================================================
diff --git a/test/files/presentation/scope-completion-import/Test.scala b/test/files/presentation/scope-completion-import/Test.scala
new file mode 100644
index 0000000000..bec1131c4c
--- /dev/null
+++ b/test/files/presentation/scope-completion-import/Test.scala
@@ -0,0 +1,3 @@
+import scala.tools.nsc.interactive.tests.InteractiveTest
+
+object Test extends InteractiveTest \ No newline at end of file
diff --git a/test/files/presentation/scope-completion-import/src/Completions.scala b/test/files/presentation/scope-completion-import/src/Completions.scala
new file mode 100644
index 0000000000..6e08321283
--- /dev/null
+++ b/test/files/presentation/scope-completion-import/src/Completions.scala
@@ -0,0 +1,64 @@
+package test
+
+class C {
+ def fCCC : Int = 0
+}
+
+object O extends C {
+ def fOOO : Int = 0
+}
+
+class Foo {
+ {
+ val o = O
+ import o._
+ /*_*/
+ }
+ {
+ import O._
+ /*_*/
+ }
+ {
+ val c = new C
+ import c._
+ /*_*/
+ }
+ {
+ f/*_*/
+ val c = new C
+ import c._
+ f/*_*/
+ import O._
+ f/*_*/
+ }
+}
+
+class Foo_1 {
+
+ import O._
+
+ def bar {
+ /*_*/
+ }
+}
+
+class Foo_2 {
+
+ val o = O
+ import o._
+
+ def bar {
+ /*_*/
+ }
+}
+
+class Foo_3 {
+
+ val c = new C
+ import c._
+
+ def bar {
+ /*_*/
+ }
+}
+
diff --git a/test/files/presentation/t1207.check b/test/files/presentation/t1207.check
index 84bfd79d75..0eed4ece04 100644
--- a/test/files/presentation/t1207.check
+++ b/test/files/presentation/t1207.check
@@ -2,7 +2,7 @@ reload: Completions.scala
askTypeCompletion at Completions.scala(10,15)
================================================================================
-[response] askCompletionAt (10,15)
+[response] askTypeCompletion at (10,15)
retrieved 3 members
final package bongo
final package lang
@@ -11,7 +11,7 @@ final package util
askTypeCompletion at Completions.scala(11,16)
================================================================================
-[response] askCompletionAt (11,16)
+[response] askTypeCompletion at (11,16)
retrieved 3 members
final package bongo
final package lang
@@ -20,7 +20,7 @@ final package util
askTypeCompletion at Completions.scala(12,19)
================================================================================
-[response] askCompletionAt (12,19)
+[response] askTypeCompletion at (12,19)
retrieved 3 members
final package bongo
final package lang
@@ -29,7 +29,7 @@ final package util
askTypeCompletion at Completions.scala(13,19)
================================================================================
-[response] askCompletionAt (13,19)
+[response] askTypeCompletion at (13,19)
retrieved 3 members
final package bongo
final package lang
@@ -38,7 +38,7 @@ final package util
askTypeCompletion at Completions.scala(14,23)
================================================================================
-[response] askCompletionAt (14,23)
+[response] askTypeCompletion at (14,23)
retrieved 3 members
final package bongo
final package lang
@@ -47,7 +47,7 @@ final package util
askTypeCompletion at Completions.scala(15,10)
================================================================================
-[response] askCompletionAt (15,10)
+[response] askTypeCompletion at (15,10)
retrieved 0 members
================================================================================
diff --git a/test/files/presentation/t5708.check b/test/files/presentation/t5708.check
index 5f17c0b762..04806b5867 100644
--- a/test/files/presentation/t5708.check
+++ b/test/files/presentation/t5708.check
@@ -2,7 +2,7 @@ reload: Completions.scala
askTypeCompletion at Completions.scala(17,9)
================================================================================
-[response] askCompletionAt (17,9)
+[response] askTypeCompletion at (17,9)
retrieved 39 members
[inaccessible] private def privateM: String
[inaccessible] private[this] val privateV: String
diff --git a/test/files/presentation/t7915.check b/test/files/presentation/t7915.check
new file mode 100644
index 0000000000..b18b4ddb55
--- /dev/null
+++ b/test/files/presentation/t7915.check
@@ -0,0 +1,11 @@
+reload: Foo.scala
+
+askHyperlinkPos for `Bar` at (7,11) Foo.scala
+================================================================================
+[response] found askHyperlinkPos for `Bar` at (1,7) Foo.scala
+================================================================================
+
+askHyperlinkPos for `bar` at (7,22) Foo.scala
+================================================================================
+[response] found askHyperlinkPos for `bar` at (2,7) Foo.scala
+================================================================================
diff --git a/test/files/presentation/t7915/Test.scala b/test/files/presentation/t7915/Test.scala
new file mode 100644
index 0000000000..c2f89bdb17
--- /dev/null
+++ b/test/files/presentation/t7915/Test.scala
@@ -0,0 +1,8 @@
+import scala.tools.nsc.interactive.tests.InteractiveTest
+
+object Test extends InteractiveTest {
+ override def runDefaultTests() {
+ sourceFiles foreach (src => askLoadedTyped(src).get)
+ super.runDefaultTests()
+ }
+}
diff --git a/test/files/presentation/t7915/src/Foo.scala b/test/files/presentation/t7915/src/Foo.scala
new file mode 100644
index 0000000000..a4166ae5b4
--- /dev/null
+++ b/test/files/presentation/t7915/src/Foo.scala
@@ -0,0 +1,9 @@
+class Bar {
+ def bar(b: Int = 2) {}
+}
+
+class Foo {
+ def foo() {
+ new Bar/*#*/().bar/*#*/()
+ }
+}
diff --git a/test/files/presentation/visibility.check b/test/files/presentation/visibility.check
index 078e0a2342..217da34b9c 100644
--- a/test/files/presentation/visibility.check
+++ b/test/files/presentation/visibility.check
@@ -2,7 +2,7 @@ reload: Completions.scala
askTypeCompletion at Completions.scala(14,12)
================================================================================
-[response] askCompletionAt (14,12)
+[response] askTypeCompletion at (14,12)
retrieved 37 members
[inaccessible] private[this] def secretPrivateThis(): Unit
def +(other: String): String
@@ -42,7 +42,7 @@ protected[package lang] def finalize(): Unit
askTypeCompletion at Completions.scala(16,11)
================================================================================
-[response] askCompletionAt (16,11)
+[response] askTypeCompletion at (16,11)
retrieved 37 members
def +(other: String): String
def ->[B](y: B): (accessibility.Foo, B)
@@ -82,7 +82,7 @@ protected[package lang] def finalize(): Unit
askTypeCompletion at Completions.scala(22,11)
================================================================================
-[response] askCompletionAt (22,11)
+[response] askTypeCompletion at (22,11)
retrieved 37 members
[inaccessible] private def secretPrivate(): Unit
def +(other: String): String
@@ -122,7 +122,7 @@ protected[package lang] def finalize(): Unit
askTypeCompletion at Completions.scala(28,10)
================================================================================
-[response] askCompletionAt (28,10)
+[response] askTypeCompletion at (28,10)
retrieved 37 members
[inaccessible] private def secretPrivate(): Unit
[inaccessible] private[this] def secretPrivateThis(): Unit
@@ -162,7 +162,7 @@ protected[package accessibility] def secretProtectedInPackage(): Unit
askTypeCompletion at Completions.scala(37,8)
================================================================================
-[response] askCompletionAt (37,8)
+[response] askTypeCompletion at (37,8)
retrieved 37 members
[inaccessible] private def secretPrivate(): Unit
[inaccessible] private[this] def secretPrivateThis(): Unit
diff --git a/test/files/run/Course-2002-05.scala b/test/files/run/Course-2002-05.scala
index e6764b92c8..80317bc757 100644
--- a/test/files/run/Course-2002-05.scala
+++ b/test/files/run/Course-2002-05.scala
@@ -3,15 +3,15 @@
//############################################################################
object M0 {
- def partition[a](xs: List[a], pred: a => Boolean): Pair[List[a], List[a]] = {
+ def partition[a](xs: List[a], pred: a => Boolean): Tuple2[List[a], List[a]] = {
if (xs.isEmpty)
- Pair(List(),List())
+ (List(),List())
else {
val tailPartition = partition(xs.tail, pred);
if (pred(xs.head))
- Pair(xs.head :: tailPartition._1, tailPartition._2)
+ (xs.head :: tailPartition._1, tailPartition._2)
else
- Pair(tailPartition._1, xs.head :: tailPartition._2)
+ (tailPartition._1, xs.head :: tailPartition._2)
}
}
@@ -49,9 +49,9 @@ object M0 {
//############################################################################
object M1 {
- def partition[a](xs: List[a], pred: a => Boolean): Pair[List[a], List[a]] = {
- xs.foldRight[Pair[List[a], List[a]]](Pair(List(), List())) {
- (x, p) => if (pred (x)) Pair(x :: p._1, p._2) else Pair(p._1, x :: p._2)
+ def partition[a](xs: List[a], pred: a => Boolean): Tuple2[List[a], List[a]] = {
+ xs.foldRight[Tuple2[List[a], List[a]]]((List(), List())) {
+ (x, p) => if (pred (x)) (x :: p._1, p._2) else (p._1, x :: p._2)
}
}
@@ -136,7 +136,7 @@ object M3 {
def adjoinRow(placement: Placement): List[Placement] =
range(1, n)
.filter (column => isSafe(column, placement))
- .map (column => Pair(row, column) :: placement);
+ .map (column => (row, column) :: placement);
placeQueens(row - 1) flatMap adjoinRow
}
diff --git a/test/files/run/Course-2002-06.scala b/test/files/run/Course-2002-06.scala
index e4fb86a966..908a934041 100644
--- a/test/files/run/Course-2002-06.scala
+++ b/test/files/run/Course-2002-06.scala
@@ -55,7 +55,7 @@ abstract class Graphics(_width: Double, _height: Double) {
}
/** Draw a list of segments on the picture.*/
- def drawSegments(frm: Frame)(segments: List[Pair[Vector, Vector]]): Unit =
+ def drawSegments(frm: Frame)(segments: List[Tuple2[Vector, Vector]]): Unit =
if (segments.isEmpty) ()
else {
drawSegment(frm)(segments.head._1, segments.head._2);
diff --git a/test/files/run/Course-2002-07.scala b/test/files/run/Course-2002-07.scala
index 055ff74d81..2d9457653f 100644
--- a/test/files/run/Course-2002-07.scala
+++ b/test/files/run/Course-2002-07.scala
@@ -181,10 +181,10 @@ object M4 {
object M5 {
- def zipFun[a,b](xs:List[a], ys:List[b]):List[Pair[a,b]] = Pair(xs,ys) match {
- case Pair(List(), _) => List()
- case Pair(_, List()) => List()
- case Pair(x :: xs1, y :: ys1) => Pair(x, y) :: zipFun(xs1, ys1)
+ def zipFun[a,b](xs:List[a], ys:List[b]):List[Tuple2[a,b]] = (xs,ys) match {
+ case (List(), _) => List()
+ case (_, List()) => List()
+ case (x :: xs1, y :: ys1) => (x, y) :: zipFun(xs1, ys1)
}
def test_zipFun[a,b](xs: List[a], ys: List[b]) = {
@@ -216,9 +216,9 @@ object M5 {
object M6 {
- def zipFun[a,b](xs:List[a], ys:List[b]):List[Pair[a,b]] = (Pair(xs,ys): @unchecked) match {
- // !!! case Pair(List(), _), Pair(_, List()) => List()
- case Pair(x :: xs1, y :: ys1) => Pair(x, y) :: zipFun(xs1, ys1)
+ def zipFun[a,b](xs:List[a], ys:List[b]):List[Tuple2[a,b]] = ((xs,ys): @unchecked) match {
+ // !!! case (List(), _), (_, List()) => List()
+ case (x :: xs1, y :: ys1) => (x, y) :: zipFun(xs1, ys1)
}
def test_zipFun[a,b](xs: List[a], ys: List[b]) = {
@@ -374,9 +374,9 @@ object M9 {
object MA {
- def lookup[k,v](xs: List[Pair[k,v]], k: k): v = xs match {
+ def lookup[k,v](xs: List[Tuple2[k,v]], k: k): v = xs match {
case List() => sys.error("no value for " + k)
- case Pair(k1,v1) :: xs1 => if (k1 == k) v1 else lookup(xs1, k)
+ case (k1,v1) :: xs1 => if (k1 == k) v1 else lookup(xs1, k)
}
trait Expr {
@@ -437,8 +437,8 @@ object MA {
val g1 = g0 derive x;
Console.println("g (x) = " + g0);
Console.println("g'(x) = " + g1);
- Console.println("g (3) = " + evalvars(List(Pair("x",3)))(g0));
- Console.println("g'(3) = " + evalvars(List(Pair("x",3)))(g1));
+ Console.println("g (3) = " + evalvars(List(("x",3)))(g0));
+ Console.println("g'(3) = " + evalvars(List(("x",3)))(g1));
Console.println;
}
@@ -453,26 +453,26 @@ object Utils {
if (y == 1) x else if (y % 2 == 0) power0(x*x,y/2) else x*power0(x, y-1);
def power(x: Int, y: Int): Int = (x,y) match {
- case Pair(0,0) => sys.error("power(0,0)")
- case Pair(0,_) => 0
- case Pair(1,_) => 1
- case Pair(_,0) => 1
- case Pair(_,1) => x
- case Pair(_,2) => x*x
- case Pair(_,_) => if (y < 0) 1/power0(x,y) else power0(x,y)
+ case (0,0) => sys.error("power(0,0)")
+ case (0,_) => 0
+ case (1,_) => 1
+ case (_,0) => 1
+ case (_,1) => x
+ case (_,2) => x*x
+ case (_,_) => if (y < 0) 1/power0(x,y) else power0(x,y)
}
def lookup(entries: List[(String,Int)], key: String): Int = entries match {
case List() => sys.error("no value for " + key)
- case Pair(k,v) :: _ if (k == key) => v
+ case (k,v) :: _ if (k == key) => v
case _ :: rest => lookup(rest, key)
}
def compare(xs: List[String], ys: List[String]): Int = (xs, ys) match {
- case Pair(List(), List()) => 0
- case Pair(List(), _ ) => -1
- case Pair(_ , List()) => +1
- case Pair(x::xs , y::ys ) => {
+ case (List(), List()) => 0
+ case (List(), _ ) => -1
+ case (_ , List()) => +1
+ case (x::xs , y::ys ) => {
val diff = x.compareTo(y);
if (diff != 0) diff else compare(xs,ys)
}
@@ -508,18 +508,18 @@ object MB {
private def +< (that: Expr): Boolean = (this +<? that) < 0;
private def +<= (that: Expr): Boolean = (this +<? that) <= 0;
- private def +<? (that: Expr): Int = Pair(this,that) match {
- case Pair(Add(_,_), _ ) => 0
- case Pair(_ , Add(_,_)) => 0
- case Pair(_ , _ ) => compare(this.vars,that.vars)
+ private def +<? (that: Expr): Int = (this,that) match {
+ case (Add(_,_), _ ) => 0
+ case (_ , Add(_,_)) => 0
+ case (_ , _ ) => compare(this.vars,that.vars)
}
- def + (that: Expr): Expr = if (that +<= this) Pair(this,that) match {
- case Pair(_ , Lit(0) ) => this
- case Pair(Lit(l) , Lit(r) ) => Lit(l + r)
- case Pair(_ , Add(rl,rr)) => (this + rl) + rr
- case Pair(Add(ll,lr), _ ) if (lr +<= that) => ll + (that + lr)
- case Pair(_ , _ ) => {
+ def + (that: Expr): Expr = if (that +<= this) (this,that) match {
+ case (_ , Lit(0) ) => this
+ case (Lit(l) , Lit(r) ) => Lit(l + r)
+ case (_ , Add(rl,rr)) => (this + rl) + rr
+ case (Add(ll,lr), _ ) if (lr +<= that) => ll + (that + lr)
+ case (_ , _ ) => {
val l = this.term;
val r = that.term;
if (l equ r) Lit(this.count + that.count) * r else Add(this, that)
@@ -528,41 +528,41 @@ object MB {
private def *< (that: Expr): Boolean = (this *<? that) < 0;
private def *<= (that: Expr): Boolean = (this *<? that) <= 0;
- private def *<? (that: Expr): Int = Pair(this,that) match {
- case Pair(Mul(_,_), _ ) => 0
- case Pair(_ , Mul(_,_)) => 0
- case Pair(Add(_,_), Add(_,_)) => 0
- case Pair(Add(_,_), _ ) => -1
- case Pair(_ , Add(_,_)) => +1
- case Pair(Lit(_) , Lit(_) ) => 0
- case Pair(Lit(_) , _ ) => -1
- case Pair(_ , Lit(_) ) => +1
- case Pair(Var(l) , Var(r) ) => l.compareTo(r)
- case Pair(Var(_) , Pow(r,_)) => if (this *<= r) -1 else +1
- case Pair(Pow(l,_), Var(_) ) => if (l *< that) -1 else +1
- case Pair(Pow(l,_), Pow(r,_)) => l *<? r
+ private def *<? (that: Expr): Int = (this,that) match {
+ case (Mul(_,_), _ ) => 0
+ case (_ , Mul(_,_)) => 0
+ case (Add(_,_), Add(_,_)) => 0
+ case (Add(_,_), _ ) => -1
+ case (_ , Add(_,_)) => +1
+ case (Lit(_) , Lit(_) ) => 0
+ case (Lit(_) , _ ) => -1
+ case (_ , Lit(_) ) => +1
+ case (Var(l) , Var(r) ) => l.compareTo(r)
+ case (Var(_) , Pow(r,_)) => if (this *<= r) -1 else +1
+ case (Pow(l,_), Var(_) ) => if (l *< that) -1 else +1
+ case (Pow(l,_), Pow(r,_)) => l *<? r
}
- def * (that: Expr): Expr = if (this *<= that) Pair(this,that) match {
- case Pair(Lit(0) , _ ) => this
- case Pair(Lit(1) , _ ) => that
- case Pair(Mul(ll,lr), r ) => ll * (lr * r)
- case Pair(Add(ll,lr), r ) => ll * r + lr * r
- case Pair(Lit(l) , Lit(r) ) => Lit(l * r)
- case Pair(Var(_) , Var(_) ) if (this equ that) => Pow(this,2)
- case Pair(Var(_) , Pow(r,n) ) if (this equ r) => Pow(this,n + 1)
- case Pair(Pow(ll,lr), Pow(rl,rr)) if (ll equ rl) => Pow(ll,lr + rr)
- case Pair(l , Mul(rl,rr)) if (rl *<= l) => (rl * l) * rr
- case Pair(_ , _ ) => Mul(this,that)
+ def * (that: Expr): Expr = if (this *<= that) (this,that) match {
+ case (Lit(0) , _ ) => this
+ case (Lit(1) , _ ) => that
+ case (Mul(ll,lr), r ) => ll * (lr * r)
+ case (Add(ll,lr), r ) => ll * r + lr * r
+ case (Lit(l) , Lit(r) ) => Lit(l * r)
+ case (Var(_) , Var(_) ) if (this equ that) => Pow(this,2)
+ case (Var(_) , Pow(r,n) ) if (this equ r) => Pow(this,n + 1)
+ case (Pow(ll,lr), Pow(rl,rr)) if (ll equ rl) => Pow(ll,lr + rr)
+ case (l , Mul(rl,rr)) if (rl *<= l) => (rl * l) * rr
+ case (_ , _ ) => Mul(this,that)
} else that * this;
def ^ (that: Int): Expr = (this,that) match {
- case Pair(_ ,1) => this
- case Pair(Lit(i) ,n) => Lit(power(i,n))
- case Pair(Var(_) ,n) => Pow(this,n)
- case Pair(Add(_,_),n) => this * (this ^ (n - 1))
- case Pair(Mul(l,r),n) => (l ^ n) * (r ^ n)
- case Pair(Pow(e,m),n) => Pow(e,m + n)
+ case (_ ,1) => this
+ case (Lit(i) ,n) => Lit(power(i,n))
+ case (Var(_) ,n) => Pow(this,n)
+ case (Add(_,_),n) => this * (this ^ (n - 1))
+ case (Mul(l,r),n) => (l ^ n) * (r ^ n)
+ case (Pow(e,m),n) => Pow(e,m + n)
}
def derive(v: Var): Expr = this match {
@@ -581,12 +581,12 @@ object MB {
case Pow(l, r) => power(l.evaluate(vars), r)
}
- def equ(that: Expr): Boolean = Pair(this,that) match {
- case Pair(Lit(l) ,Lit(r)) => l == r
- case Pair(Var(l) ,Var(r)) => l == r
- case Pair(Add(ll,lr),Add(rl,rr)) => (ll equ rl) && (lr equ rr)
- case Pair(Mul(ll,lr),Mul(rl,rr)) => (ll equ rl) && (lr equ rr)
- case Pair(Pow(ll,lr),Pow(rl,rr)) => (ll equ rl) && (lr == rr)
+ def equ(that: Expr): Boolean = (this,that) match {
+ case (Lit(l) ,Lit(r)) => l == r
+ case (Var(l) ,Var(r)) => l == r
+ case (Add(ll,lr),Add(rl,rr)) => (ll equ rl) && (lr equ rr)
+ case (Mul(ll,lr),Mul(rl,rr)) => (ll equ rl) && (lr equ rr)
+ case (Pow(ll,lr),Pow(rl,rr)) => (ll equ rl) && (lr == rr)
case _ => false
}
@@ -667,7 +667,7 @@ object MB {
Console.println;
def check(n: String, f: Expr, x: Int, e: Int) {
- val a: Int = f.evaluate(List(Pair("x",x)));
+ val a: Int = f.evaluate(List(("x",x)));
val s: String = if (a == e) "ok" else "KO(" + e + ")";
Console.println(n + "(" + x + ") = " + a + " " + s);
}
diff --git a/test/files/run/Course-2002-08.scala b/test/files/run/Course-2002-08.scala
index 38b8363661..5e21edaba3 100644
--- a/test/files/run/Course-2002-08.scala
+++ b/test/files/run/Course-2002-08.scala
@@ -163,7 +163,7 @@ object M5 {
}
abstract class Simulation() {
- private type Agenda = List[Pair[Int, Action]];
+ private type Agenda = List[Tuple2[Int, Action]];
private var agenda: Agenda = List();
private var curtime = 0;
def currentTime: Int = curtime;
@@ -171,17 +171,17 @@ object M5 {
def afterDelay(delay: Int)(action: Action): Unit = {
def insert(ag: Agenda, time: Int): Agenda = ag match {
case List() =>
- List(Pair(time, action))
- case Pair(t, act) :: ag1 =>
- if (time < t) Pair(time, action) :: ag
- else Pair(t, act) :: insert(ag1, time)
+ List((time, action))
+ case (t, act) :: ag1 =>
+ if (time < t) (time, action) :: ag
+ else (t, act) :: insert(ag1, time)
}
agenda = insert(agenda, curtime + delay)
}
private def next: Unit = agenda match {
case List() => ()
- case Pair(time, action) :: ag1 => {
+ case (time, action) :: ag1 => {
agenda = ag1;
curtime = time;
action();
@@ -413,7 +413,7 @@ object M5 {
class Simulator() {
type Action = () => Unit;
- type Agenda = List[Pair[Int, Action]];
+ type Agenda = List[Tuple2[Int, Action]];
private var agenda: Agenda = List();
private var curtime = 0;
@@ -421,17 +421,17 @@ class Simulator() {
def afterDelay(delay: Int)(action: Action) = {
def insert(ag: Agenda, time: Int): Agenda = ag match {
case List() =>
- List(Pair(time, action))
- case Pair(t, act) :: ag1 =>
- if (time < t) Pair(time, action) :: ag
- else Pair(t, act) :: insert(ag1, time)
+ List((time, action))
+ case (t, act) :: ag1 =>
+ if (time < t) (time, action) :: ag
+ else (t, act) :: insert(ag1, time)
}
agenda = insert(agenda, curtime + delay)
}
def next: Unit = agenda match {
case List() => ()
- case Pair(time, action) :: rest => {
+ case (time, action) :: rest => {
agenda = rest;
curtime = time;
action();
@@ -567,8 +567,8 @@ class Main() extends CircuitSimulator() {
demux(in, ctrl.reverse, out.reverse);
probe("in", in);
- for (Pair(x,c) <- range(0,n) zip ctrl) { probe("ctrl" + x, c) }
- for (Pair(x,o) <- range(0,outNum) zip out) { probe("out" + x, o) }
+ for ((x,c) <- range(0,n) zip ctrl) { probe("ctrl" + x, c) }
+ for ((x,o) <- range(0,outNum) zip out) { probe("out" + x, o) }
in.setSignal(true);
run;
diff --git a/test/files/run/Course-2002-09.scala b/test/files/run/Course-2002-09.scala
index 87f91111d8..704f2ec0aa 100644
--- a/test/files/run/Course-2002-09.scala
+++ b/test/files/run/Course-2002-09.scala
@@ -13,11 +13,11 @@ object NoConstraint extends Constraint {
}
class Adder(a1: Quantity,a2: Quantity,sum: Quantity) extends Constraint {
- def newValue = Triple(a1.getValue, a2.getValue, sum.getValue) match {
- case Triple(Some(x1), Some(x2), _ ) => sum.setValue(x1 + x2, this)
- case Triple(Some(x1), _ , Some(r)) => a2.setValue(r - x1, this)
- case Triple(_ , Some(x2), Some(r)) => a1.setValue(r - x2, this)
- case _ =>
+ def newValue = (a1.getValue, a2.getValue, sum.getValue) match {
+ case (Some(x1), Some(x2), _ ) => sum.setValue(x1 + x2, this)
+ case (Some(x1), _ , Some(r)) => a2.setValue(r - x1, this)
+ case (_ , Some(x2), Some(r)) => a1.setValue(r - x2, this)
+ case _ =>
}
def dropValue: Unit = {
a1.forgetValue(this); a2.forgetValue(this); sum.forgetValue(this);
@@ -29,13 +29,13 @@ class Adder(a1: Quantity,a2: Quantity,sum: Quantity) extends Constraint {
class Multiplier(m1: Quantity, m2: Quantity, prod: Quantity)
extends Constraint {
- def newValue = Triple(m1.getValue, m2.getValue, prod.getValue) match {
- case Triple(Some(0d), _ , _ ) => prod.setValue(0, this);
- case Triple(_ , Some(0d), _ ) => prod.setValue(0, this);
- case Triple(Some(x1), Some(x2), _ ) => prod.setValue(x1 * x2, this)
- case Triple(Some(x1), _ , Some(r)) => m2.setValue(r / x1, this)
- case Triple(_, Some(x2), Some(r)) => m1.setValue(r / x2, this)
- case _ =>
+ def newValue = (m1.getValue, m2.getValue, prod.getValue) match {
+ case (Some(0d), _ , _ ) => prod.setValue(0, this);
+ case (_ , Some(0d), _ ) => prod.setValue(0, this);
+ case (Some(x1), Some(x2), _ ) => prod.setValue(x1 * x2, this)
+ case (Some(x1), _ , Some(r)) => m2.setValue(r / x1, this)
+ case (_, Some(x2), Some(r)) => m1.setValue(r / x2, this)
+ case _ =>
}
def dropValue: Unit = {
m1.forgetValue(this); m2.forgetValue(this); prod.forgetValue(this);
@@ -46,11 +46,11 @@ class Multiplier(m1: Quantity, m2: Quantity, prod: Quantity)
}
class Squarer(square: Quantity, root: Quantity) extends Constraint {
- def newValue: Unit = Pair(square.getValue, root.getValue) match {
- case Pair(Some(x), _ )if (x < 0) => sys.error("Square of negative number")
- case Pair(Some(x), _ ) => root.setValue(Math.sqrt(x), this)
- case Pair(_ , Some(x)) => square.setValue(x*x, this)
- case _ =>
+ def newValue: Unit = (square.getValue, root.getValue) match {
+ case (Some(x), _ )if (x < 0) => sys.error("Square of negative number")
+ case (Some(x), _ ) => root.setValue(Math.sqrt(x), this)
+ case (_ , Some(x)) => square.setValue(x*x, this)
+ case _ =>
}
def dropValue: Unit = {
square.forgetValue(this); root.forgetValue(this);
@@ -60,9 +60,9 @@ class Squarer(square: Quantity, root: Quantity) extends Constraint {
}
class Eq(a: Quantity, b: Quantity) extends Constraint {
- def newValue = (Pair(a.getValue, b.getValue): @unchecked) match {
- case Pair(Some(x), _ ) => b.setValue(x, this);
- case Pair(_ , Some(y)) => a.setValue(y, this);
+ def newValue = ((a.getValue, b.getValue): @unchecked) match {
+ case (Some(x), _ ) => b.setValue(x, this);
+ case (_ , Some(y)) => a.setValue(y, this);
}
def dropValue {
a.forgetValue(this); b.forgetValue(this);
diff --git a/test/files/run/Course-2002-13.scala b/test/files/run/Course-2002-13.scala
index 4bd3614fb0..a596a33873 100644
--- a/test/files/run/Course-2002-13.scala
+++ b/test/files/run/Course-2002-13.scala
@@ -74,18 +74,18 @@ object Terms {
val NoTerm = Con("<none>", List());
- def unify1(x: Term, y: Term, s: Subst): Option[Subst] = Pair(x, y) match {
- case Pair(Var(a), Var(b)) if (a == b) =>
+ def unify1(x: Term, y: Term, s: Subst): Option[Subst] = (x, y) match {
+ case (Var(a), Var(b)) if (a == b) =>
Some(s)
- case Pair(Var(a), _) => lookup(s, a) match {
+ case (Var(a), _) => lookup(s, a) match {
case Some(x1) => unify(x1, y, s)
case None => if (y.tyvars contains a) None else Some(Binding(a, y) :: s)
}
- case Pair(_, Var(b)) => lookup(s, b) match {
+ case (_, Var(b)) => lookup(s, b) match {
case Some(y1) => unify(x, y1, s)
case None => if (x.tyvars contains b) None else Some(Binding(b, x) :: s)
}
- case Pair(Con(a, xs), Con(b, ys)) if (a == b) =>
+ case (Con(a, xs), Con(b, ys)) if (a == b) =>
unify(xs, ys, s)
case _ => None
}
@@ -96,9 +96,9 @@ object Terms {
ss
}
- def unify(xs: List[Term], ys: List[Term], s: Subst): Option[Subst] = Pair(xs, ys) match {
- case Pair(List(), List()) => Some(s)
- case Pair(x :: xs1, y :: ys1) =>
+ def unify(xs: List[Term], ys: List[Term], s: Subst): Option[Subst] = (xs, ys) match {
+ case (List(), List()) => Some(s)
+ case (x :: xs1, y :: ys1) =>
unify(x, y, s) match {
case Some(s1) => unify(xs1, ys1, s1)
case None => None
diff --git a/test/files/run/bugs.scala b/test/files/run/bugs.scala
index ba8449c299..02849b5817 100644
--- a/test/files/run/bugs.scala
+++ b/test/files/run/bugs.scala
@@ -46,7 +46,7 @@ object Bug135Test {
def test(args: Array[String]) {
val myMap:TreeMap[Int, String] = new TreeMap
- val map1 = myMap + Pair(42, "The answer")
+ val map1 = myMap + ((42, "The answer"))
println(map1.get(42))
}
diff --git a/test/files/run/ctries-old/main.scala b/test/files/run/ctries-old/main.scala
index f714bcdcdc..77161fed2f 100644
--- a/test/files/run/ctries-old/main.scala
+++ b/test/files/run/ctries-old/main.scala
@@ -38,7 +38,7 @@ trait Spec {
var produced = false
try body
catch {
- case e: Throwable => if (e.getClass == implicitly[ClassManifest[T]].erasure) produced = true
+ case e: Throwable => if (e.getClass == implicitly[ClassManifest[T]].runtimeClass) produced = true
} finally {
assert(produced, "Did not produce exception of type: " + implicitly[ClassManifest[T]])
}
diff --git a/test/files/run/fors.check b/test/files/run/fors.check
new file mode 100644
index 0000000000..b459f00b49
--- /dev/null
+++ b/test/files/run/fors.check
@@ -0,0 +1,28 @@
+
+testOld
+1 2 3
+2
+2
+3
+1 2 3
+1 2 3
+0 1 2 3 4 5 6 7 8 9
+0 2 4 6 8
+0 2 4 6 8
+a b c
+b c
+b c
+
+testNew
+3
+1 2 3
+1 2 3
+0 1 2 3 4 5 6 7 8 9
+0 2 4 6 8
+0 2 4 6 8
+0 2 4 6 8
+0 2 4 6 8
+0 2 4 6 8
+0 2 4 6 8
+0 2 4 6 8
+a b c
diff --git a/test/files/run/fors.scala b/test/files/run/fors.scala
new file mode 100644
index 0000000000..c778df3e24
--- /dev/null
+++ b/test/files/run/fors.scala
@@ -0,0 +1,84 @@
+//############################################################################
+// for-comprehensions (old and new syntax)
+//############################################################################
+
+//############################################################################
+
+object Test extends App {
+ val xs = List(1, 2, 3)
+ val ys = List('a, 'b, 'c)
+
+ def it = 0 until 10
+
+ val ar = "abc".toCharArray
+
+ /////////////////// old syntax ///////////////////
+
+ def testOld {
+ println("\ntestOld")
+
+ // lists
+ for (x <- xs) print(x + " "); println
+ for (x <- xs;
+ if x % 2 == 0) print(x + " "); println
+ for {x <- xs
+ if x % 2 == 0} print(x + " "); println
+ var n = 0
+ for (_ <- xs) n += 1; println(n)
+ for ((x, y) <- xs zip ys) print(x + " "); println
+ for (p @ (x, y) <- xs zip ys) print(p._1 + " "); println
+
+ // iterators
+ for (x <- it) print(x + " "); println
+ for (x <- it;
+ if x % 2 == 0) print(x + " "); println
+ for {x <- it
+ if x % 2 == 0} print(x + " "); println
+
+ // arrays
+ for (x <- ar) print(x + " "); println
+ for (x <- ar;
+ if x.toInt > 97) print(x + " "); println
+ for {x <- ar
+ if x.toInt > 97} print(x + " "); println
+
+ }
+
+ /////////////////// new syntax ///////////////////
+
+ def testNew {
+ println("\ntestNew")
+
+ // lists
+ var n = 0
+ for (_ <- xs) n += 1; println(n)
+ for ((x, y) <- xs zip ys) print(x + " "); println
+ for (p @ (x, y) <- xs zip ys) print(p._1 + " "); println
+
+ // iterators
+ for (x <- it) print(x + " "); println
+ for (x <- it if x % 2 == 0) print(x + " "); println
+ for (x <- it; if x % 2 == 0) print(x + " "); println
+ for (x <- it;
+ if x % 2 == 0) print(x + " "); println
+ for (x <- it
+ if x % 2 == 0) print(x + " "); println
+ for {x <- it
+ if x % 2 == 0} print(x + " "); println
+ for (x <- it;
+ y = 2
+ if x % y == 0) print(x + " "); println
+ for {x <- it
+ y = 2
+ if x % y == 0} print(x + " "); println
+
+ // arrays
+ for (x <- ar) print(x + " "); println
+
+ }
+
+ ////////////////////////////////////////////////////
+
+ testOld
+ testNew
+}
diff --git a/test/files/run/getClassTest-old.scala b/test/files/run/getClassTest-old.scala
index 789dd4d162..cd1b6b07f6 100644
--- a/test/files/run/getClassTest-old.scala
+++ b/test/files/run/getClassTest-old.scala
@@ -53,7 +53,7 @@ class MoreAnyRefs {
@deprecated("Suppress warnings", since="2.11")
object Test {
def returnTypes[T: Manifest] = (
- manifest[T].erasure.getMethods.toList
+ manifest[T].runtimeClass.getMethods.toList
filter (_.getName startsWith "f")
sortBy (_.getName)
map (m => m.getName + ": " + m.getGenericReturnType.toString)
diff --git a/test/files/run/map_test.scala b/test/files/run/map_test.scala
index 1ea864ed58..b76dfb4577 100644
--- a/test/files/run/map_test.scala
+++ b/test/files/run/map_test.scala
@@ -20,7 +20,7 @@ object Test extends App {
val map2 = map1.updated(17,"A small random number")
val map3 = map2.updated(666,"A bigger random number")
val map4 = map3.updated(4711,"A big random number")
- map1 == myMap + Pair(42, "The answer")
+ map1 == myMap + ((42, "The answer"))
var i = 0
var map = map4
while(i < 43) {
diff --git a/test/files/run/mutable-anyrefmap.scala b/test/files/run/mutable-anyrefmap.scala
new file mode 100644
index 0000000000..ff615d0daf
--- /dev/null
+++ b/test/files/run/mutable-anyrefmap.scala
@@ -0,0 +1,91 @@
+object Test extends App {
+
+ import scala.collection.mutable.HashMap;
+ import scala.collection.mutable.AnyRefMap;
+
+ val keys = Array(
+ null, "perch", "herring", "salmon", "pike", "cod", ""
+ )
+
+ val rn = new scala.util.Random(42L)
+ var arm = AnyRefMap.empty[String, Int]
+ val hm = HashMap.empty[String, Int]
+
+ def checkConsistent = hm.forall{ case (k,v) => arm.get(k).exists(_ == v) }
+
+ assert {
+ (0 to 10000).forall{ i =>
+ val k = keys(rn.nextInt(keys.length))
+ if (rn.nextInt(100) < 2) arm = arm.clone()
+ if (rn.nextInt(100) < 5) arm.repack()
+ if (rn.nextBoolean) {
+ hm += ((k, i))
+ rn.nextInt(6) match {
+ case 0 => arm += ((k, i))
+ case 1 => arm += (k, i)
+ case 2 => arm(k) = i
+ case 3 => arm.put(k,i)
+ case 4 => arm ++= List((k,i))
+ case _ => if (!arm.contains(k)) arm.getOrElseUpdate(k,i)
+ else arm += (k,i)
+ }
+ }
+ else {
+ hm -= k
+ rn.nextInt(2) match {
+ case 0 => arm -= k
+ case _ => arm --= List(k)
+ }
+ }
+ checkConsistent
+ }
+ }
+
+ assert {
+ val mapped =
+ arm.map{ case (k,v) => (if (k==null) "" else k+k) -> v.toString }
+ mapped.getClass == arm.getClass
+ }
+
+ assert {
+ val arm2 = new AnyRefMap[java.lang.Integer,Unit](2000000)
+ for (i <- 0 until 1000000) arm2(java.lang.Integer.valueOf(i)) = ()
+
+ arm2.size == 1000000 &&
+ (0 to 1100000 by 100000).map(java.lang.Integer.valueOf).forall(i => (arm2 contains i) == i < 1000000)
+ }
+
+ arm = AnyRefMap("heron" -> 22, "dove" -> 5, "budgie" -> 0)
+
+ assert{
+ var s = ""
+ arm.foreachKey(s += _)
+
+ s.length == "herondovebudgie".length &&
+ s.contains("heron") &&
+ s.contains("dove") &&
+ s.contains("budgie")
+ }
+
+ assert{ var s = 0L; arm.foreachValue(s += _); s == 27L }
+
+ assert {
+ val m2 = arm.mapValuesNow(_+2)
+ arm.transformValues(_+2)
+ m2 == arm && !(m2 eq arm) && (for ((_,v) <- arm) yield v).sum == 33L
+ }
+
+ assert {
+ val arm2 = new AnyRefMap[String, String](x => if (x==null) "null" else x)
+ arm2 += ("cod" -> "fish", "Rarity" -> "unicorn")
+ val hm2 = (new HashMap[String,String]) ++= arm2
+
+ List(null, "cod", "sparrow", "Rarity").forall(i =>
+ arm2.get(i) == hm2.get(i) &&
+ arm2.getOrElse(i, "") == hm2.getOrElse(i, "") &&
+ arm2(i) == hm2.get(i).getOrElse(if (i==null) "null" else i.toString) &&
+ arm2.getOrNull(i) == hm2.get(i).orNull
+ )
+ }
+}
+
diff --git a/test/files/run/mutable-longmap.scala b/test/files/run/mutable-longmap.scala
new file mode 100644
index 0000000000..07fd80f6f0
--- /dev/null
+++ b/test/files/run/mutable-longmap.scala
@@ -0,0 +1,79 @@
+object Test extends App {
+
+ import scala.collection.mutable.HashMap;
+ import scala.collection.mutable.LongMap;
+
+ val keys = Array(
+ Long.MinValue, Int.MinValue - 1L, Int.MinValue, -9127, -1,
+ 0, 1, 9127, Int.MaxValue, Long.MaxValue
+ )
+
+ val rn = new scala.util.Random(42L)
+ var lm = LongMap.empty[Long]
+ val hm = HashMap.empty[Long,Long]
+
+ def checkConsistent = hm.forall{ case (k,v) => lm.get(k).exists(_ == v) }
+
+ assert {
+ (0 to 10000).forall{ i =>
+ val k = keys(rn.nextInt(keys.length))
+ if (rn.nextInt(100) < 2) lm = lm.clone()
+ if (rn.nextInt(100) < 5) lm.repack()
+ if (rn.nextBoolean) {
+ hm += ((k, i))
+ rn.nextInt(6) match {
+ case 0 => lm += ((k, i))
+ case 1 => lm += (k, i)
+ case 2 => lm(k) = i
+ case 3 => lm.put(k,i)
+ case 4 => lm ++= List((k,i))
+ case _ => if (!lm.contains(k)) lm.getOrElseUpdate(k,i)
+ else lm += (k,i)
+ }
+ }
+ else {
+ hm -= k
+ rn.nextInt(2) match {
+ case 0 => lm -= k
+ case _ => lm --= List(k)
+ }
+ }
+ checkConsistent
+ }
+ }
+
+ assert {
+ lm.map{ case (k,v) => -k*k -> v.toString }.getClass == lm.getClass
+ }
+
+ assert {
+ val lm2 = new LongMap[Unit](2000000)
+ for (i <- 0 until 1000000) lm2(i) = ()
+
+ lm2.size == 1000000 &&
+ (0 to 1100000 by 100000).forall(i => (lm2 contains i) == i < 1000000)
+ }
+
+ lm = LongMap(8L -> 22L, -5L -> 5L, Long.MinValue -> 0L)
+
+ assert{ var s = 0L; lm.foreachKey(s += _); s == Long.MinValue + 3 }
+ assert{ var s = 0L; lm.foreachValue(s += _); s == 27L }
+ assert {
+ val m2 = lm.mapValuesNow(_+2)
+ lm.transformValues(_+2)
+ m2 == lm && !(m2 eq lm) && (for ((_,v) <- lm) yield v).sum == 33L
+ }
+
+ assert {
+ val lm2 = new LongMap[String](_.toString)
+ lm2 += (5L -> "fish", 0L -> "unicorn")
+ val hm2 = (new HashMap[Long,String]) ++= lm2
+
+ List(Long.MinValue, 0L, 1L, 5L).forall(i =>
+ lm2.get(i) == hm2.get(i) &&
+ lm2.getOrElse(i, "") == hm2.getOrElse(i, "") &&
+ lm2(i) == hm2.get(i).getOrElse(i.toString) &&
+ lm2.getOrNull(i) == hm2.get(i).orNull
+ )
+ }
+}
diff --git a/test/files/run/patmatnew.scala b/test/files/run/patmatnew.scala
index b212e10f8d..3c0d00dc6c 100644
--- a/test/files/run/patmatnew.scala
+++ b/test/files/run/patmatnew.scala
@@ -46,7 +46,7 @@ object Test {
object SimpleUnapply {
def run() { // from sortedmap, old version
List((1, 2)).head match {
- case kv@Pair(key, _) => kv.toString + " " + key.toString
+ case kv@(key, _) => kv.toString + " " + key.toString
}
}
@@ -400,9 +400,9 @@ object Test {
// these are exhaustive matches
// should not generate any warnings
def f[A](z: (Option[A], Option[A])) = z match {
- case Pair(None, Some(x)) => 1
- case Pair(Some(x), None) => 2
- case Pair(Some(x), Some(y)) => 3
+ case (None, Some(x)) => 1
+ case (Some(x), None) => 2
+ case (Some(x), Some(y)) => 3
case _ => 4
}
@@ -419,9 +419,9 @@ object Test {
}
def h[A](x: (Option[A], Option[A])) = x match {
- case Pair(None, _: Some[_]) => 1
- case Pair(_: Some[_], None) => 2
- case Pair(_: Some[_], _: Some[_]) => 3
+ case (None, _: Some[_]) => 1
+ case (_: Some[_], None) => 2
+ case (_: Some[_], _: Some[_]) => 3
case _ => 4
}
@@ -539,17 +539,17 @@ object Test {
case class Operator(x: Int);
val EQ = new Operator(2);
- def analyze(x: Pair[Operator, Int]) = x match {
- case Pair(EQ, 0) => "0"
- case Pair(EQ, 1) => "1"
- case Pair(EQ, 2) => "2"
+ def analyze(x: Tuple2[Operator, Int]) = x match {
+ case (EQ, 0) => "0"
+ case (EQ, 1) => "1"
+ case (EQ, 2) => "2"
}
def run() {
- val x = Pair(EQ, 0);
+ val x = (EQ, 0);
assertEquals("0", analyze(x)); // should print "0"
- val y = Pair(EQ, 1);
+ val y = (EQ, 1);
assertEquals("1", analyze(y)); // should print "1"
- val z = Pair(EQ, 2);
+ val z = (EQ, 2);
assertEquals("2", analyze(z)); // should print "2"
}
}
diff --git a/test/files/run/repl-backticks.check b/test/files/run/repl-backticks.check
new file mode 100644
index 0000000000..c0561abd7c
--- /dev/null
+++ b/test/files/run/repl-backticks.check
@@ -0,0 +1,2 @@
+import java.lang.Thread.`yield`
+import scala.`package`.Throwable
diff --git a/test/files/run/repl-backticks.scala b/test/files/run/repl-backticks.scala
new file mode 100644
index 0000000000..e40a8bc662
--- /dev/null
+++ b/test/files/run/repl-backticks.scala
@@ -0,0 +1,18 @@
+import scala.tools.nsc._
+
+object Test {
+ val testCode = """
+ import java.lang.Thread.`yield`
+ import scala.`package`.Throwable
+
+ `yield`
+ """
+
+ def main(args: Array[String]) {
+ val settings = new Settings()
+ settings.classpath.value = System.getProperty("java.class.path")
+ val repl = new interpreter.IMain(settings)
+ repl.interpret(testCode)
+ }
+}
+
diff --git a/test/files/run/t1500.check b/test/files/run/t1500.check
new file mode 100644
index 0000000000..94a169333b
--- /dev/null
+++ b/test/files/run/t1500.check
@@ -0,0 +1,3 @@
+defined class posingAs
+resolve: [A, B](x: A @posingAs[B])B
+x: Any = 7
diff --git a/test/files/run/t1500.scala b/test/files/run/t1500.scala
new file mode 100644
index 0000000000..30c026f70f
--- /dev/null
+++ b/test/files/run/t1500.scala
@@ -0,0 +1,46 @@
+import scala.tools.nsc._
+
+object Test {
+
+ /**
+ * Type inference overlooks constraints posed by type parameters in annotations on types.
+ */
+
+ val testCode = """
+
+ class posingAs[A] extends annotation.TypeConstraint
+
+ def resolve[A,B](x: A @posingAs[B]): B = x.asInstanceOf[B]
+
+ val x = resolve(7: @posingAs[Any])
+
+ """
+
+ def main(args: Array[String]) {
+
+ val settings = new Settings()
+ settings.classpath.value = System.getProperty("java.class.path")
+ val tool = new interpreter.IMain(settings)
+ val global = tool.global
+
+ import global._
+ import definitions._
+
+ object checker extends AnnotationChecker {
+
+ /** Check annotations to decide whether tpe1 <:< tpe2 */
+ def annotationsConform(tpe1: Type, tpe2: Type): Boolean = {
+
+ tpe1.annotations.forall(a1 => tpe2.annotations.forall(a2 => a1.atp <:< a2.atp))
+
+ }
+ }
+
+ global.addAnnotationChecker(checker)
+
+ tool.interpret(testCode)
+
+ }
+
+}
+
diff --git a/test/files/run/t1501.check b/test/files/run/t1501.check
new file mode 100644
index 0000000000..f0fa9112a5
--- /dev/null
+++ b/test/files/run/t1501.check
@@ -0,0 +1,3 @@
+defined class xyz
+loopWhile: [T](cond: => Boolean)(body: => Unit @xyz[T])Unit @xyz[T]
+test: ()Unit @xyz[Int]
diff --git a/test/files/run/t1501.scala b/test/files/run/t1501.scala
new file mode 100644
index 0000000000..ca6bf357fb
--- /dev/null
+++ b/test/files/run/t1501.scala
@@ -0,0 +1,56 @@
+import scala.tools.nsc._
+
+object Test {
+
+ /**
+ * ...
+ */
+
+ val testCode = """
+
+ class xyz[A] extends annotation.TypeConstraint
+
+ def loopWhile[T](cond: =>Boolean)(body: =>(Unit @xyz[T])): Unit @ xyz[T] = {{
+ if (cond) {{
+ body
+ loopWhile[T](cond)(body)
+ }}
+ }}
+
+ def test() = {{
+ var x = 7
+ loopWhile(x != 0) {{
+ x = x - 1
+ (): @xyz[Int]
+ }}
+ }}
+
+ """
+
+ def main(args: Array[String]) {
+ val settings = new Settings()
+ settings.classpath.value = System.getProperty("java.class.path")
+ val tool = new interpreter.IMain(settings)
+ val global = tool.global
+
+ import global._
+ import definitions._
+
+ object checker extends AnnotationChecker {
+
+ /** Check annotations to decide whether tpe1 <:< tpe2 */
+ def annotationsConform(tpe1: Type, tpe2: Type): Boolean = {
+
+ tpe1.annotations.forall(a1 => tpe2.annotations.forall(a2 => a1.atp <:< a2.atp))
+
+ }
+ }
+
+ global.addAnnotationChecker(checker)
+
+ tool.interpret(testCode)
+
+ }
+
+}
+
diff --git a/test/files/run/t3888.scala b/test/files/run/t3888.scala
index 19771041fc..8701b42ff0 100644
--- a/test/files/run/t3888.scala
+++ b/test/files/run/t3888.scala
@@ -24,6 +24,6 @@ object Test {
}
}
-class P extends Pair(1, 1) {
+class P extends Tuple2(1, 1) {
override def equals(x: Any) = true
}
diff --git a/test/files/run/t4124.check b/test/files/run/t4124.check
new file mode 100644
index 0000000000..66a0092d93
--- /dev/null
+++ b/test/files/run/t4124.check
@@ -0,0 +1,4 @@
+hi
+hi
+bye
+bye
diff --git a/test/files/run/t4124.scala b/test/files/run/t4124.scala
new file mode 100644
index 0000000000..9f35b57ce3
--- /dev/null
+++ b/test/files/run/t4124.scala
@@ -0,0 +1,24 @@
+import xml.Node
+
+object Test extends App {
+ val body: Node = <elem>hi</elem>
+ println ((body: AnyRef, "foo") match {
+ case (node: Node, "bar") => "bye"
+ case (ser: Serializable, "foo") => "hi"
+ })
+
+ println ((body, "foo") match {
+ case (node: Node, "bar") => "bye"
+ case (ser: Serializable, "foo") => "hi"
+ })
+
+ println ((body: AnyRef, "foo") match {
+ case (node: Node, "foo") => "bye"
+ case (ser: Serializable, "foo") => "hi"
+ })
+
+ println ((body: AnyRef, "foo") match {
+ case (node: Node, "foo") => "bye"
+ case (ser: Serializable, "foo") => "hi"
+ })
+}
diff --git a/test/files/run/t6329_repl_bug.check b/test/files/run/t6329_repl_bug.check
new file mode 100644
index 0000000000..44c41cfd03
--- /dev/null
+++ b/test/files/run/t6329_repl_bug.check
@@ -0,0 +1,17 @@
+Type in expressions to have them evaluated.
+Type :help for more information.
+
+scala> import scala.reflect.runtime.universe._
+import scala.reflect.runtime.universe._
+
+scala> import scala.reflect.runtime._
+import scala.reflect.runtime._
+
+scala> classManifest[List[_]]
+warning: there were 1 deprecation warning(s); re-run with -deprecation for details
+res0: scala.reflect.ClassTag[List[_]] = scala.collection.immutable.List[<?>]
+
+scala> scala.reflect.classTag[List[_]]
+res1: scala.reflect.ClassTag[List[_]] = scala.collection.immutable.List
+
+scala>
diff --git a/test/files/run/t6329_repl_bug.pending b/test/files/run/t6329_repl_bug.scala
index 9997d1771e..9997d1771e 100644
--- a/test/files/run/t6329_repl_bug.pending
+++ b/test/files/run/t6329_repl_bug.scala
diff --git a/test/files/run/t6329_vanilla_bug.check b/test/files/run/t6329_vanilla_bug.check
new file mode 100644
index 0000000000..640d168a8a
--- /dev/null
+++ b/test/files/run/t6329_vanilla_bug.check
@@ -0,0 +1,3 @@
+warning: there were 1 deprecation warning(s); re-run with -deprecation for details
+scala.collection.immutable.List[<?>]
+scala.collection.immutable.List
diff --git a/test/files/run/t6329_vanilla_bug.pending b/test/files/run/t6329_vanilla_bug.scala
index 404f90bf6e..404f90bf6e 100644
--- a/test/files/run/t6329_vanilla_bug.pending
+++ b/test/files/run/t6329_vanilla_bug.scala
diff --git a/test/files/run/tailcalls.scala b/test/files/run/tailcalls.scala
index e5d8891cc7..1653b14de9 100644
--- a/test/files/run/tailcalls.scala
+++ b/test/files/run/tailcalls.scala
@@ -169,7 +169,7 @@ class TailCall[S](s: S) {
aux[T](x, y);
}
final def g3[T](x: Int, y: Int, zs: List[T]): Int = {
- def aux[U](n: Int, v: Int, ls: List[Pair[T,U]]): Int =
+ def aux[U](n: Int, v: Int, ls: List[Tuple2[T,U]]): Int =
if (n == 0) v else aux(n - 1, v - 1, ls);
aux(x, y, Nil);
}
diff --git a/test/files/run/tcpoly_parseridioms.check b/test/files/run/tcpoly_parseridioms.check
index ab829e0a0e..8bd0a086d6 100644
--- a/test/files/run/tcpoly_parseridioms.check
+++ b/test/files/run/tcpoly_parseridioms.check
@@ -4,8 +4,8 @@ It would fail on the following input: ParseResult()
^
tcpoly_parseridioms.scala:17: warning: match may not be exhaustive.
It would fail on the following input: ParseResult()
- def apply(in: Input): ParseResult[Pair[T, U]] = a(in) match {
- ^
+ def apply(in: Input): ParseResult[Tuple2[T, U]] = a(in) match {
+ ^
tcpoly_parseridioms.scala:30: warning: match may not be exhaustive.
It would fail on the following input: ParseResult()
case Failure(_, _) => b(in) match {
diff --git a/test/files/run/tcpoly_parseridioms.scala b/test/files/run/tcpoly_parseridioms.scala
index c8bcf693a1..d22f68b558 100644
--- a/test/files/run/tcpoly_parseridioms.scala
+++ b/test/files/run/tcpoly_parseridioms.scala
@@ -13,10 +13,10 @@ trait Parsers {
}
// sequence
- def sq[T, U](a: => Parser[T], b: => Parser[U]): Parser[Pair[T, U]] = new Parser[Pair[T, U]] {
- def apply(in: Input): ParseResult[Pair[T, U]] = a(in) match {
+ def sq[T, U](a: => Parser[T], b: => Parser[U]): Parser[Tuple2[T, U]] = new Parser[Tuple2[T, U]] {
+ def apply(in: Input): ParseResult[Tuple2[T, U]] = a(in) match {
case Success(next, x) => b(next) match {
- case Success(next2, y) => Success(next2, Pair(x,y))
+ case Success(next2, y) => Success(next2, (x,y))
case Failure(_, msg) => Failure(in, msg)
}
case Failure(_, msg) => Failure(in, msg)
@@ -49,7 +49,7 @@ trait Parsers {
}
}
- def apply_++[s, tt](fun: Parser[s => tt], arg: Parser[s]): Parser[tt] = lift[Pair[s=>tt, s], tt]({case Pair(f, a) => f(a)})(sq(fun, arg))
+ def apply_++[s, tt](fun: Parser[s => tt], arg: Parser[s]): Parser[tt] = lift[Tuple2[s=>tt, s], tt]({case (f, a) => f(a)})(sq(fun, arg))
def success[u](v: u): Parser[u] = new Parser[u] {
def apply(in: Input) = Success(in, v)
diff --git a/test/files/run/withIndex.scala b/test/files/run/withIndex.scala
index 910b1f1f9e..ebf1941c95 100644
--- a/test/files/run/withIndex.scala
+++ b/test/files/run/withIndex.scala
@@ -11,7 +11,7 @@ object Test {
Console.println(str.zipWithIndex.toList)
assert {
ary.zipWithIndex match {
- case _: Array[Pair[_,_]] => true
+ case _: Array[Tuple2[_,_]] => true
case _ => false
}
}
diff --git a/test/files/scalacheck/CheckCollections.scala b/test/files/scalacheck/CheckCollections.scala
index 108040b900..329d505b47 100644
--- a/test/files/scalacheck/CheckCollections.scala
+++ b/test/files/scalacheck/CheckCollections.scala
@@ -1,4 +1,4 @@
-import org.scalacheck.{ ConsoleReporter, Properties }
+import org.scalacheck.Properties
import org.scalacheck.Prop._
import scala.reflect.internal.util.Collections._
@@ -49,11 +49,4 @@ object Test extends Properties("reflect.internal.util.Collections") {
for {
(label, prop) <- tests
} property(label) = prop
-
- import org.scalacheck.{ Test => STest }
-
- def runTests() =
- STest.checkProperties(
- STest.Params(testCallback = ConsoleReporter(0)), this)
-
}
diff --git a/test/files/scalacheck/CheckEither.scala b/test/files/scalacheck/CheckEither.scala
index 4d0cab4693..48f732a22d 100644
--- a/test/files/scalacheck/CheckEither.scala
+++ b/test/files/scalacheck/CheckEither.scala
@@ -1,10 +1,8 @@
-import org.scalacheck.{ Arbitrary, ConsoleReporter, Prop, Properties }
+import org.scalacheck.{ Arbitrary, Prop, Properties }
import org.scalacheck.Arbitrary.{arbitrary, arbThrowable}
import org.scalacheck.Gen.oneOf
-import org.scalacheck.util.StdRand
import org.scalacheck.Prop._
-import org.scalacheck.Test.{Params, check}
-import org.scalacheck.ConsoleReporter.testStatsEx
+import org.scalacheck.Test.check
import Function.tupled
object Test extends Properties("Either") {
@@ -178,10 +176,4 @@ object Test extends Properties("Either") {
for ((label, prop) <- tests) {
property(label) = prop
}
-
- import org.scalacheck.{ Test => STest }
-
- def runTests() = {
- STest.checkProperties(STest.Params(testCallback = ConsoleReporter(0)), this)
- }
}
diff --git a/test/files/scalacheck/array-new.scala b/test/files/scalacheck/array-new.scala
index e13a47a5d5..d8c69ead78 100644
--- a/test/files/scalacheck/array-new.scala
+++ b/test/files/scalacheck/array-new.scala
@@ -1,4 +1,4 @@
-import scala.reflect.{ClassTag, classTag}
+import scala.reflect.ClassTag // new style: use ClassTag
import org.scalacheck._
import Prop._
import Gen._
diff --git a/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala b/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala
index c4b93dae48..7905a2ca15 100644
--- a/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala
+++ b/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala
@@ -222,7 +222,7 @@ trait ArbitraryTreesAndNames {
yield ValDef(mods, name, tpt, rhs)
def genTree(size: Int): Gen[Tree] =
- if (size <= 1) oneOf(EmptyTree, genTreeIsTerm(size), genTreeIsType(size))
+ if (size <= 1) oneOf(EmptyTree: Gen[Tree], genTreeIsTerm(size), genTreeIsType(size))
else oneOf(genTree(1),
// these trees are neither terms nor types
genPackageDef(size - 1), genModuleDef(size - 1),
@@ -273,8 +273,8 @@ trait ArbitraryTreesAndNames {
def apply(universe: Universe, value: TreeIsType): universe.Tree =
value.tree.asInstanceOf[universe.Tree]
}
- implicit def treeIsTerm2tree(tit: TreeIsTerm) = tit.tree
- implicit def treeIsType2tree(tit: TreeIsType) = tit.tree
+ implicit def treeIsTerm2tree(tit: TreeIsTerm): Tree = tit.tree
+ implicit def treeIsType2tree(tit: TreeIsType): Tree = tit.tree
implicit val arbConstant: Arbitrary[Constant] = Arbitrary(genConstant)
implicit val arbModifiers: Arbitrary[Modifiers] = Arbitrary(genModifiers)
diff --git a/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala b/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala
index b2bce124ee..b331c4b6b6 100644
--- a/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala
+++ b/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala
@@ -18,13 +18,12 @@ trait Helpers {
object simplify extends Transformer {
object SimplifiedName {
- def unapply[T <: Name](name: T): Option[T] =
- name.toString.split("\\$").toSeq match {
- case first :+ last if scala.util.Try(last.toInt).isSuccess && first.nonEmpty =>
- val value = first.mkString("", "$", "$")
- Some((if (name.isTermName) TermName(value) else TypeName(value)).asInstanceOf[T])
- case _ => None
- }
+ val st = scala.reflect.runtime.universe.asInstanceOf[scala.reflect.internal.SymbolTable]
+ val FreshName = new st.FreshNameExtractor
+ def unapply[T <: Name](name: T): Option[T] = name.asInstanceOf[st.Name] match {
+ case FreshName(prefix) =>
+ Some((if (name.isTermName) TermName(prefix) else TypeName(prefix)).asInstanceOf[T])
+ }
}
override def transform(tree: Tree): Tree = tree match {
@@ -59,7 +58,7 @@ trait Helpers {
}
def assertThrows[T <: AnyRef](f: => Any)(implicit manifest: Manifest[T]): Unit = {
- val clazz = manifest.erasure.asInstanceOf[Class[T]]
+ val clazz = manifest.runtimeClass.asInstanceOf[Class[T]]
val thrown =
try {
f
diff --git a/test/files/scalacheck/si4147.scala b/test/files/scalacheck/si4147.scala
index 05507b1b18..72f6e9afd5 100644
--- a/test/files/scalacheck/si4147.scala
+++ b/test/files/scalacheck/si4147.scala
@@ -1,8 +1,6 @@
import org.scalacheck.Prop.{forAll, throws}
import org.scalacheck.Properties
-import org.scalacheck.ConsoleReporter.testStatsEx
import org.scalacheck.Gen
-import org.scalacheck.ConsoleReporter
import collection.mutable
@@ -66,5 +64,5 @@ object Test extends Properties("Mutable TreeSet") {
}
property("ordering must not be null") =
- throws(mutable.TreeSet.empty[Int](null), classOf[NullPointerException])
+ throws(classOf[NullPointerException])(mutable.TreeSet.empty[Int](null))
}
diff --git a/test/files/scalacheck/t2460.scala b/test/files/scalacheck/t2460.scala
index 196b43789f..ab2911447a 100644
--- a/test/files/scalacheck/t2460.scala
+++ b/test/files/scalacheck/t2460.scala
@@ -1,6 +1,5 @@
import org.scalacheck.Prop.forAll
import org.scalacheck.Properties
-import org.scalacheck.ConsoleReporter.testStatsEx
import org.scalacheck.{Test => SCTest}
import org.scalacheck.Gen
@@ -25,8 +24,4 @@ object Test extends Properties("Regex : Ticket 2460") {
("numberOfGroup", numberOfGroup),
("nameOfGroup", nameOfGroup)
)
-
- /*tests foreach {
- case (name, p) => testStatsEx(name, SCTest.check(p))
- }*/
}
diff --git a/test/files/scalacheck/treeset.scala b/test/files/scalacheck/treeset.scala
index 7fca3ed5e4..4b9b77dd7e 100644
--- a/test/files/scalacheck/treeset.scala
+++ b/test/files/scalacheck/treeset.scala
@@ -151,5 +151,5 @@ object Test extends Properties("TreeSet") {
}
property("ordering must not be null") =
- throws(TreeSet.empty[Int](null), classOf[NullPointerException])
+ throws(classOf[NullPointerException])(TreeSet.empty[Int](null))
}
diff --git a/test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala b/test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala
new file mode 100644
index 0000000000..cf09abdfff
--- /dev/null
+++ b/test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala
@@ -0,0 +1,47 @@
+package scala.tools.nsc
+package symtab
+
+import org.junit.Assert._
+import org.junit.Test
+import org.junit.runner.RunWith
+import org.junit.runners.JUnit4
+
+import scala.tools.testing.AssertUtil.assertThrows
+import scala.reflect.internal.util.FreshNameCreator
+
+@RunWith(classOf[JUnit4])
+class FreshNameExtractorTest {
+ object symbolTable extends SymbolTableForUnitTesting
+ import symbolTable._
+
+ val prefixes = List("foo$", "x$", "bar", "bippy$baz$")
+
+ @Test
+ def extractionPreservesPrefix =
+ ("" :: prefixes).foreach { creatorPrefix =>
+ prefixes.foreach { newPrefix =>
+ val Creator = new FreshNameCreator(creatorPrefix)
+ val Extractor = new FreshNameExtractor(creatorPrefix)
+ val Extractor(extractedPrefix) = TermName(Creator.newName(newPrefix))
+ assertEquals(newPrefix, extractedPrefix)
+ }
+ }
+
+ @Test
+ def extractionFailsOnCreatorPrefixMismatch = {
+ val Creator = new FreshNameCreator(prefixes.head)
+ val Extractor = new FreshNameExtractor(prefixes.tail.head)
+ assertThrows[MatchError] {
+ val Extractor(_) = TermName(Creator.newName("foo"))
+ }
+ }
+
+ @Test
+ def extractionsFailsIfNameDoesntEndWithNumber = {
+ val Creator = new FreshNameCreator(prefixes.head)
+ val Extractor = new FreshNameExtractor(prefixes.head)
+ assertThrows[MatchError] {
+ val Extractor(_) = TermName(Creator.newName("foo") + "bar")
+ }
+ }
+} \ No newline at end of file
diff --git a/test/pending/run/reify_callccinterpreter.scala b/test/pending/run/reify_callccinterpreter.scala
index d9f7736769..82c70da28f 100644
--- a/test/pending/run/reify_callccinterpreter.scala
+++ b/test/pending/run/reify_callccinterpreter.scala
@@ -43,15 +43,15 @@ object Test extends App {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -67,12 +67,12 @@ object Test extends App {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
- case Ccc(x, t) => callCC(k => interp(t, Pair(x, Fun(k)) :: e))
+ case Ccc(x, t) => callCC(k => interp(t, (x, Fun(k)) :: e))
}
def test(t: Term): String = showM(interp(t, List()))
diff --git a/test/pending/run/reify_simpleinterpreter.scala b/test/pending/run/reify_simpleinterpreter.scala
index 6cf87ea7c5..1f6d6c8da7 100644
--- a/test/pending/run/reify_simpleinterpreter.scala
+++ b/test/pending/run/reify_simpleinterpreter.scala
@@ -32,15 +32,15 @@ object Test extends App {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]]
+ type Environment = List[Tuple2[Name, Value]]
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -56,7 +56,7 @@ object Test extends App {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
diff --git a/test/pending/shootout/fasta.scala b/test/pending/shootout/fasta.scala
index 8b711083a5..ae99ba5936 100644
--- a/test/pending/shootout/fasta.scala
+++ b/test/pending/shootout/fasta.scala
@@ -5,7 +5,7 @@
import java.io._
-object fasta {
+object fasta {
def main(args: Array[String]) = {
val ALU =
@@ -18,31 +18,31 @@ object fasta {
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
val _IUB = Array(
- Pair('a', 0.27),
- Pair('c', 0.12),
- Pair('g', 0.12),
- Pair('t', 0.27),
-
- Pair('B', 0.02),
- Pair('D', 0.02),
- Pair('H', 0.02),
- Pair('K', 0.02),
- Pair('M', 0.02),
- Pair('N', 0.02),
- Pair('R', 0.02),
- Pair('S', 0.02),
- Pair('V', 0.02),
- Pair('W', 0.02),
- Pair('Y', 0.02)
+ ('a', 0.27),
+ ('c', 0.12),
+ ('g', 0.12),
+ ('t', 0.27),
+
+ ('B', 0.02),
+ ('D', 0.02),
+ ('H', 0.02),
+ ('K', 0.02),
+ ('M', 0.02),
+ ('N', 0.02),
+ ('R', 0.02),
+ ('S', 0.02),
+ ('V', 0.02),
+ ('W', 0.02),
+ ('Y', 0.02)
)
val IUB = makeCumulative(_IUB)
val _HomoSapiens = Array(
- Pair('a', 0.3029549426680),
- Pair('c', 0.1979883004921),
- Pair('g', 0.1975473066391),
- Pair('t', 0.3015094502008)
+ ('a', 0.3029549426680),
+ ('c', 0.1979883004921),
+ ('g', 0.1975473066391),
+ ('t', 0.3015094502008)
)
val HomoSapiens = makeCumulative(_HomoSapiens)
@@ -61,15 +61,15 @@ object fasta {
s.writeRandomSequence(HomoSapiens,n*5)
s.close
- }
+ }
- def makeCumulative(a: Array[Pair[Char,Double]]) = {
+ def makeCumulative(a: Array[Tuple2[Char,Double]]) = {
var cp = 0.0
a map (frequency =>
- frequency match {
- case Pair(code,percent) =>
- cp = cp + percent; new Frequency(code.toByte,cp)
- }
+ frequency match {
+ case (code,percent) =>
+ cp = cp + percent; new Frequency(code.toByte,cp)
+ }
)
}
@@ -79,7 +79,7 @@ object fasta {
// We could use instances of Pair or Tuple2 but specific labels
// make the code more readable than index numbers
-class Frequency(_code: Byte, _percent: Double){
+class Frequency(_code: Byte, _percent: Double){
var code = _code; var percent = _percent;
}
@@ -101,13 +101,13 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
val m = if (n < LineLength) n else LineLength
var i = 0
- while (i < m){
+ while (i < m){
if (k == kn) k = 0
val b = alu(k)
if (count < buf.length){ buf(count) = b; count = count + 1 }
else { write(b) } // flush buffer
k = k+1
- i = i+1
+ i = i+1
}
write(nl)
@@ -122,11 +122,11 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
val m = if (n < LineLength) n else LineLength
var i = 0
- while (i < m){
+ while (i < m){
val b = selectRandom(distribution)
if (count < buf.length){ buf(count) = b; count = count + 1 }
else { write(b) } // flush buffer
- i = i+1
+ i = i+1
}
if (count < buf.length){ buf(count) = nl; count = count + 1 }
diff --git a/test/pending/shootout/revcomp.scala-2.scala b/test/pending/shootout/revcomp.scala-2.scala
index 92260ad021..03fb25af1b 100644
--- a/test/pending/shootout/revcomp.scala-2.scala
+++ b/test/pending/shootout/revcomp.scala-2.scala
@@ -6,7 +6,7 @@
import java.io._
import scala.collection.mutable.Stack
-object revcomp {
+object revcomp {
val IUB = IUBCodeComplements
@@ -16,7 +16,7 @@ object revcomp {
val a: Array[Byte] = new Array( 'z'.toByte )
for (indexValue <- code zip comp)
- indexValue match { case Pair(i,v) => a(i) = v }
+ indexValue match { case (i,v) => a(i) = v }
a
}
@@ -49,18 +49,18 @@ object revcomp {
if (desc.length > 0) complementReverseWrite(desc, lines, w)
w.close
- }
+ }
- def complementReverseWrite(desc: String, lines: LineStack,
+ def complementReverseWrite(desc: String, lines: LineStack,
w: BufferedOutputStream) = {
def inplaceComplementReverse(b: Array[Byte]) = {
- var i = 0
+ var i = 0
var j = b.length - 1
while (i < j){
- val swap = b(i)
- b(i) = IUB( b(j) )
+ val swap = b(i)
+ b(i) = IUB( b(j) )
b(j) = IUB( swap )
i = i + 1
j = j - 1
@@ -79,11 +79,11 @@ object revcomp {
while (!lines.isEmpty) {
val line = lines.pop
inplaceComplementReverse(line)
-
+
if (isSplitLine){
if (isFirstLine){ w.write(line); isFirstLine = false }
else { w.write(line,0,n-k); w.write(nl); w.write(line,n-k,k) }
- }
+ }
else { w.write(line); w.write(nl) }
}
if (isSplitLine && !isFirstLine) w.write(nl)
diff --git a/test/pending/shootout/revcomp.scala-3.scala b/test/pending/shootout/revcomp.scala-3.scala
index ae12f0499b..39a0409127 100644
--- a/test/pending/shootout/revcomp.scala-3.scala
+++ b/test/pending/shootout/revcomp.scala-3.scala
@@ -6,7 +6,7 @@
import java.io._
import scala.collection.mutable.Stack
-object revcomp {
+object revcomp {
def main(args: Array[String]) = {
val out = new FastaOutputStream(System.out)
val in = new FastaInputStream(System.in)
@@ -17,12 +17,12 @@ object revcomp {
in.close
out.close
- }
+ }
}
trait FastaByteStream {
- val nl = '\n'.toByte
+ val nl = '\n'.toByte
type Line = Array[Byte]
type LineStack = Stack[Line]
@@ -31,13 +31,13 @@ trait FastaByteStream {
// extend the Java BufferedInputStream class
-final class FastaInputStream(in: InputStream)
+final class FastaInputStream(in: InputStream)
extends BufferedInputStream(in) with FastaByteStream {
val gt = '>'.toByte
val sc = ';'.toByte
- def readSequenceStack(): Pair[Line,LineStack] = {
+ def readSequenceStack(): Tuple2[Line,LineStack] = {
var header: Line = null
val lines: LineStack = new Stack
@@ -49,14 +49,14 @@ final class FastaInputStream(in: InputStream)
header = line
} else {
pos = pos - line.length - 1 // reposition to start of line
- return Pair(header,lines)
+ return (header,lines)
}
} else {
if (c != sc) lines push line // ';'
}
line = readLine()
}
- return Pair(header,lines)
+ return (header,lines)
}
def readLine() = {
@@ -65,7 +65,7 @@ final class FastaInputStream(in: InputStream)
else {
mark(128) // mark the start of the line
if (count == 0) read() // fill buffer
-
+
var i = markpos
while (i < count && buf(i) != nl) i = i + 1
@@ -74,11 +74,11 @@ final class FastaInputStream(in: InputStream)
while (i < count && buf(i) != nl) i = i + 1
}
- if (i < count){
+ if (i < count){
bytes = new Array(i - markpos)
System.arraycopy(buf, markpos, bytes, 0, i - markpos);
pos = i+1
- }
+ }
}
bytes
}
@@ -87,7 +87,7 @@ final class FastaInputStream(in: InputStream)
// extend the Java BufferedOutputStream class
-final class FastaOutputStream(in: OutputStream)
+final class FastaOutputStream(in: OutputStream)
extends BufferedOutputStream(in) with FastaByteStream {
private val IUB = IUBCodeComplements
@@ -98,19 +98,19 @@ final class FastaOutputStream(in: OutputStream)
val iub: Array[Byte] = new Array( 'z'.toByte )
for (indexValue <- code zip comp)
- indexValue match { case Pair(i,v) => iub(i) = v }
+ indexValue match { case (i,v) => iub(i) = v }
iub
}
- def writeReverseComplement(sequence: Pair[Line,LineStack]) = {
+ def writeReverseComplement(sequence: Tuple2[Line,LineStack]) = {
def inplaceComplementReverse(b: Array[Byte]) = {
- var i = 0
+ var i = 0
var j = b.length - 1
while (i < j){
- val swap = b(i)
- b(i) = IUB( b(j) )
+ val swap = b(i)
+ b(i) = IUB( b(j) )
b(j) = IUB( swap )
i = i + 1
j = j - 1
@@ -119,7 +119,7 @@ final class FastaOutputStream(in: OutputStream)
}
sequence match {
- case Pair(header,lines) => {
+ case (header,lines) => {
write(header); write(nl)
@@ -131,11 +131,11 @@ final class FastaOutputStream(in: OutputStream)
while (!lines.isEmpty) {
val line = lines.pop
inplaceComplementReverse(line)
-
+
if (isSplitLine){
- if (isFirstLine){ write(line); isFirstLine = false }
+ if (isFirstLine){ write(line); isFirstLine = false }
else { write(line,0,LineLength-k); write(nl); write(line,LineLength-k,k) }
- }
+ }
else { write(line); write(nl) }
}