summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
-rw-r--r--docs/examples/fors.scala2
-rw-r--r--docs/examples/iterators.scala4
-rw-r--r--docs/examples/jolib/Ref.scala8
-rw-r--r--docs/examples/jolib/parallelOr.scala22
-rw-r--r--docs/examples/monads/callccInterpreter.scala18
-rw-r--r--docs/examples/monads/directInterpreter.scala14
-rw-r--r--docs/examples/monads/errorInterpreter.scala10
-rw-r--r--docs/examples/monads/simpleInterpreter.scala14
-rw-r--r--docs/examples/monads/stateInterpreter.scala24
-rw-r--r--docs/examples/patterns.scala8
-rw-r--r--docs/examples/pilib/elasticBuffer.scala8
-rw-r--r--docs/examples/pilib/handover.scala38
-rw-r--r--docs/examples/pilib/piNat.scala16
-rw-r--r--docs/examples/typeinf.scala50
-rw-r--r--src/actors/scala/actors/Future.scala14
-rw-r--r--src/actors/scala/actors/remote/NetKernel.scala8
-rw-r--r--src/actors/scala/actors/remote/Proxy.scala4
-rw-r--r--src/actors/scala/actors/remote/RemoteActor.scala4
-rw-r--r--src/actors/scala/actors/remote/TcpService.scala8
-rw-r--r--src/compiler/scala/reflect/macros/compiler/Resolvers.scala2
-rw-r--r--src/compiler/scala/tools/ant/ScalaTool.scala4
-rw-r--r--src/compiler/scala/tools/ant/sabbus/Compilers.scala2
-rw-r--r--src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala2
-rw-r--r--src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala2
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala8
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala4
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala2
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala4
-rw-r--r--src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala22
-rw-r--r--src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala6
-rw-r--r--src/compiler/scala/tools/nsc/plugins/Plugin.scala2
-rw-r--r--src/compiler/scala/tools/nsc/reporters/Reporter.scala6
-rw-r--r--src/compiler/scala/tools/nsc/scratchpad/Mixer.scala99
-rw-r--r--src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala21
-rw-r--r--src/compiler/scala/tools/nsc/typechecker/Typers.scala2
-rw-r--r--src/compiler/scala/tools/nsc/util/package.scala35
-rw-r--r--src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala20
-rw-r--r--src/interactive/scala/tools/nsc/interactive/CompilerControl.scala37
-rw-r--r--src/interactive/scala/tools/nsc/interactive/Global.scala164
-rw-r--r--src/interactive/scala/tools/nsc/interactive/REPL.scala55
-rw-r--r--src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala201
-rw-r--r--src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala3
-rw-r--r--src/library/scala/Predef.scala6
-rw-r--r--src/library/scala/Responder.scala2
-rw-r--r--src/library/scala/annotation/migration.scala5
-rw-r--r--src/library/scala/collection/immutable/Range.scala16
-rw-r--r--src/library/scala/math/BigDecimal.scala3
-rw-r--r--src/library/scala/math/BigInt.scala3
-rw-r--r--src/library/scala/reflect/ClassManifestDeprecatedApis.scala23
-rw-r--r--src/library/scala/reflect/Manifest.scala12
-rw-r--r--src/library/scala/runtime/WorksheetSupport.scala93
-rw-r--r--src/library/scala/util/hashing/MurmurHash3.scala8
-rw-r--r--src/reflect/scala/reflect/api/JavaUniverse.scala2
-rw-r--r--src/reflect/scala/reflect/internal/Definitions.scala16
-rw-r--r--src/reflect/scala/reflect/internal/FreshNames.scala35
-rw-r--r--src/reflect/scala/reflect/internal/Mirrors.scala12
-rw-r--r--src/reflect/scala/reflect/internal/SymbolTable.scala6
-rw-r--r--src/reflect/scala/reflect/internal/Symbols.scala24
-rw-r--r--src/reflect/scala/reflect/internal/TreeInfo.scala2
-rw-r--r--src/reflect/scala/reflect/internal/util/FreshNameCreator.scala7
-rw-r--r--src/reflect/scala/reflect/runtime/JavaUniverseForce.scala1
-rw-r--r--src/repl/scala/tools/nsc/interpreter/IMain.scala3
-rw-r--r--src/repl/scala/tools/nsc/interpreter/JavapClass.scala2
-rw-r--r--src/scaladoc/scala/tools/ant/Scaladoc.scala6
-rw-r--r--src/scalap/scala/tools/scalap/Arguments.scala6
-rw-r--r--test/disabled/run/lisp.scala16
-rw-r--r--test/files/jvm/typerep.scala2
-rw-r--r--test/files/neg/class-of-double-targs.check4
-rw-r--r--test/files/neg/class-of-double-targs.scala3
-rw-r--r--test/files/neg/patmatexhaust.scala4
-rw-r--r--test/files/neg/t414.scala2
-rw-r--r--test/files/neg/t5702-neg-bad-and-wild.check2
-rw-r--r--test/files/neg/t5702-neg-bad-and-wild.scala2
-rw-r--r--test/files/neg/t997.scala2
-rw-r--r--test/files/neg/wellkinded_wrongarity.check4
-rw-r--r--test/files/neg/wellkinded_wrongarity.scala2
-rw-r--r--test/files/pos/bounds.scala6
-rw-r--r--test/files/pos/patmat.scala4
-rw-r--r--test/files/pos/spec-doubledef-new.scala6
-rw-r--r--test/files/pos/spec-doubledef-old.scala6
-rw-r--r--test/files/pos/t0064.scala2
-rw-r--r--test/files/pos/t247.scala4
-rw-r--r--test/files/pos/t443.scala8
-rw-r--r--test/files/pos/t4579.scala12
-rw-r--r--test/files/pos/t5120.scala4
-rw-r--r--test/files/pos/t7987/Macro_1.scala6
-rw-r--r--test/files/pos/t7987/Test_2.scala12
-rw-r--r--test/files/pos/tcpoly_bounds1.scala4
-rw-r--r--test/files/pos/typealiases.scala2
-rw-r--r--test/files/pos/unapplyNeedsMemberType.scala2
-rw-r--r--test/files/pos/valdefs.scala2
-rw-r--r--test/files/positions/ExcludedPrefix1.scala2
-rw-r--r--test/files/positions/Overlap4.scala2
-rw-r--r--test/files/positions/Scaladoc7.scala2
-rw-r--r--test/files/presentation/callcc-interpreter.check8
-rw-r--r--test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala32
-rw-r--r--test/files/run/Course-2002-05.scala16
-rw-r--r--test/files/run/Course-2002-06.scala2
-rw-r--r--test/files/run/Course-2002-07.scala140
-rw-r--r--test/files/run/Course-2002-08.scala28
-rw-r--r--test/files/run/Course-2002-09.scala40
-rw-r--r--test/files/run/Course-2002-13.scala16
-rw-r--r--test/files/run/bugs.scala2
-rw-r--r--test/files/run/ctries-old/main.scala2
-rw-r--r--test/files/run/getClassTest-old.scala2
-rw-r--r--test/files/run/map_test.scala2
-rw-r--r--test/files/run/patmatnew.scala28
-rw-r--r--test/files/run/t3888.scala2
-rw-r--r--test/files/run/t6329_repl_bug.check17
-rw-r--r--test/files/run/t6329_repl_bug.scala (renamed from test/files/run/t6329_repl_bug.pending)0
-rw-r--r--test/files/run/t6329_vanilla_bug.check3
-rw-r--r--test/files/run/t6329_vanilla_bug.scala (renamed from test/files/run/t6329_vanilla_bug.pending)0
-rw-r--r--test/files/run/tailcalls.scala2
-rw-r--r--test/files/run/tcpoly_parseridioms.check4
-rw-r--r--test/files/run/tcpoly_parseridioms.scala8
-rw-r--r--test/files/run/withIndex.scala2
-rw-r--r--test/files/scalacheck/CheckCollections.scala9
-rw-r--r--test/files/scalacheck/CheckEither.scala12
-rw-r--r--test/files/scalacheck/array-new.scala2
-rw-r--r--test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala6
-rw-r--r--test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala15
-rw-r--r--test/files/scalacheck/si4147.scala4
-rw-r--r--test/files/scalacheck/t2460.scala5
-rw-r--r--test/files/scalacheck/treeset.scala2
-rw-r--r--test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala47
-rw-r--r--test/pending/run/reify_callccinterpreter.scala12
-rw-r--r--test/pending/run/reify_simpleinterpreter.scala10
-rw-r--r--test/pending/shootout/fasta.scala64
-rw-r--r--test/pending/shootout/revcomp.scala-2.scala18
-rw-r--r--test/pending/shootout/revcomp.scala-3.scala40
130 files changed, 737 insertions, 1264 deletions
diff --git a/docs/examples/fors.scala b/docs/examples/fors.scala
index b937e53fcd..29616b61b1 100644
--- a/docs/examples/fors.scala
+++ b/docs/examples/fors.scala
@@ -83,7 +83,7 @@ object fors {
if b1 != b2;
Elem(_, "author", _, _, Text(a1)) <- b1.toList;
Elem(_, "author", _, _, Text(a2)) <- b2.toList;
- if a1 == a2) yield Pair(a1, a2))
+ if a1 == a2) yield (a1, a2))
def removeDuplicates[a](xs: List[a]): List[a] =
if (xs.isEmpty)
diff --git a/docs/examples/iterators.scala b/docs/examples/iterators.scala
index e2e5e050a0..9ddb141d61 100644
--- a/docs/examples/iterators.scala
+++ b/docs/examples/iterators.scala
@@ -15,8 +15,8 @@ object iterators {
def findGreater(xs: Array[Double], limit: Double) =
xs.iterator
.zip(Iterator.from(0))
- .filter{case Pair(x, i) => x > limit }
- .map{case Pair(x, i) => i}
+ .filter{case (x, i) => x > limit }
+ .map{case (x, i) => i}
def main(args: Array[String]) {
val ar = Array/*[Double]*/(6, 2, 8, 5, 1)
diff --git a/docs/examples/jolib/Ref.scala b/docs/examples/jolib/Ref.scala
index 32952b4351..099a3c2df2 100644
--- a/docs/examples/jolib/Ref.scala
+++ b/docs/examples/jolib/Ref.scala
@@ -12,20 +12,20 @@ import concurrent.SyncVar;
import concurrent.jolib._;
class Ref[a](init: a) extends Join {
-
+
object get extends Synchr[a](this) { case class C() extends SyncVar[a]; }
object set extends Synchr[unit](this) { case class C(x: a) extends SyncVar[unit]; }
object state extends Asynchr(this) { case class C(x: a); }
rules (
- Pair(List(get, state), { case List(g @ get.C(), state.C(x) ) =>
+ (List(get, state), { case List(g @ get.C(), state.C(x) ) =>
{ g.set(x); state(state.C(x)) } }),
- Pair(List(set, state), { case List(s @ set.C(x), state.C(y) ) =>
+ (List(set, state), { case List(s @ set.C(x), state.C(y) ) =>
{ s.set(()); state(state.C(x)) } })
);
state(state.C(init));
-
+
def Get: a = get(get.C());
def Set(x: a): unit = set(set.C(x));
}
diff --git a/docs/examples/jolib/parallelOr.scala b/docs/examples/jolib/parallelOr.scala
index fb8288c5b2..a0305c56bf 100644
--- a/docs/examples/jolib/parallelOr.scala
+++ b/docs/examples/jolib/parallelOr.scala
@@ -13,27 +13,27 @@ import concurrent.SyncVar;
/** Implementation in the join-calculus of a parallel OR. */
object or extends Join {
-
+
object res extends Synchr[boolean](this) { case class C() extends SyncVar[boolean] };
object res1 extends Asynchr(this) { case class C(b: boolean); }
object res2 extends Asynchr(this) { case class C(b: boolean); }
object res1False extends Synchr[boolean](this) { case class C() extends SyncVar[boolean] };
object res2False extends Synchr[boolean](this) { case class C() extends SyncVar[boolean] };
-
+
rules(
- Pair(List(res, res1), { case List(r @ res.C(), res1.C(b)) =>
+ (List(res, res1), { case List(r @ res.C(), res1.C(b)) =>
if (b) r.set(b) else r.set(res1False(res1False.C())) }),
-
- Pair(List(res, res2), { case List(r @ res.C(), res2.C(b)) =>
+
+ (List(res, res2), { case List(r @ res.C(), res2.C(b)) =>
if (b) r.set(b) else r.set(res2False(res2False.C())) }),
-
- Pair(List(res1False, res2), { case List(r @ res1False.C(), res2.C(b)) =>
+
+ (List(res1False, res2), { case List(r @ res1False.C(), res2.C(b)) =>
r.set(b) }),
-
- Pair(List(res2False, res1), { case List(r @ res2False.C(), res1.C(b)) =>
+
+ (List(res2False, res1), { case List(r @ res2False.C(), res1.C(b)) =>
r.set(b) })
);
-
+
def apply(b1: => boolean, b2: => boolean): boolean = {
concurrent.ops.spawn(res1(res1.C(b1)));
concurrent.ops.spawn(res2(res2.C(b2)));
@@ -42,7 +42,7 @@ object or extends Join {
}
*/
object parallelOr {
-
+
def main(args: Array[String]): unit = {
def loop: boolean = { while (true) {}; true };
/*
diff --git a/docs/examples/monads/callccInterpreter.scala b/docs/examples/monads/callccInterpreter.scala
index 5b556bd8fa..b5008c4c1b 100644
--- a/docs/examples/monads/callccInterpreter.scala
+++ b/docs/examples/monads/callccInterpreter.scala
@@ -14,7 +14,7 @@ object callccInterpreter {
def showM(m: M[Value]): String = (m in id).toString();
- def callCC[A](h: (A => M[A]) => M[A]) =
+ def callCC[A](h: (A => M[A]) => M[A]) =
M[A](c => h(a => M[A](d => c(a))) in c);
type Name = String;
@@ -30,7 +30,7 @@ object callccInterpreter {
trait Value;
case object Wrong extends Value {
override def toString() = "wrong"
- }
+ }
case class Num(n: Int) extends Value {
override def toString() = n.toString();
}
@@ -38,15 +38,15 @@ object callccInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -62,15 +62,15 @@ object callccInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
- case Ccc(x, t) => callCC(k => interp(t, Pair(x, Fun(k)) :: e))
+ case Ccc(x, t) => callCC(k => interp(t, (x, Fun(k)) :: e))
}
- def test(t: Term): String =
+ def test(t: Term): String =
showM(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
diff --git a/docs/examples/monads/directInterpreter.scala b/docs/examples/monads/directInterpreter.scala
index 06fffba8e2..d8ca8ccfa7 100644
--- a/docs/examples/monads/directInterpreter.scala
+++ b/docs/examples/monads/directInterpreter.scala
@@ -20,15 +20,15 @@ object directInterpreter {
case Fun(f) => "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): Value = e match {
case List() => Wrong
- case Pair(y, b) :: e1 => if (x == y) b else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) b else lookup(x, e1)
}
- def add(a: Value, b: Value): Value = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => Num(m + n)
+ def add(a: Value, b: Value): Value = (a, b) match {
+ case (Num(m), Num(n)) => Num(m + n)
case _ => Wrong
}
@@ -41,15 +41,15 @@ object directInterpreter {
case Var(x) => lookup(x, e)
case Con(n) => Num(n)
case Add(l, r) => add(interp(l, e), interp(r, e))
- case Lam(x, t) => Fun(a => interp(t, Pair(x, a) :: e))
+ case Lam(x, t) => Fun(a => interp(t, (x, a) :: e))
case App(f, t) => apply(interp(f, e), interp(t, e))
}
- def test(t: Term): String =
+ def test(t: Term): String =
showval(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
- def main(args: Array[String]) =
+ def main(args: Array[String]) =
System.out.println(test(term0));
}
diff --git a/docs/examples/monads/errorInterpreter.scala b/docs/examples/monads/errorInterpreter.scala
index d3cc45627d..c15e1041e2 100644
--- a/docs/examples/monads/errorInterpreter.scala
+++ b/docs/examples/monads/errorInterpreter.scala
@@ -41,15 +41,15 @@ object errorInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]]
+ type Environment = List[Tuple2[Name, Value]]
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => errorM("unbound variable: " + x);
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => errorM("should be numbers: " + a + "," + b)
}
@@ -65,7 +65,7 @@ object errorInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
diff --git a/docs/examples/monads/simpleInterpreter.scala b/docs/examples/monads/simpleInterpreter.scala
index cde3a92dbb..64636749ff 100644
--- a/docs/examples/monads/simpleInterpreter.scala
+++ b/docs/examples/monads/simpleInterpreter.scala
@@ -22,7 +22,7 @@ object simpleInterpreter {
trait Value;
case object Wrong extends Value {
override def toString() = "wrong"
- }
+ }
case class Num(n: Int) extends Value {
override def toString() = n.toString();
}
@@ -30,15 +30,15 @@ object simpleInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -54,14 +54,14 @@ object simpleInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
}
- def test(t: Term): String =
+ def test(t: Term): String =
showM(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
diff --git a/docs/examples/monads/stateInterpreter.scala b/docs/examples/monads/stateInterpreter.scala
index 97f3335dab..e13e9049da 100644
--- a/docs/examples/monads/stateInterpreter.scala
+++ b/docs/examples/monads/stateInterpreter.scala
@@ -4,20 +4,20 @@ object stateInterpreter {
type State = Int;
- val tickS = new M(s => Pair((), s + 1));
+ val tickS = new M(s => ((), s + 1));
- case class M[A](in: State => Pair[A, State]) {
- def bind[B](k: A => M[B]) = M[B]{ s0 =>
- val Pair(a, s1) = this in s0; k(a) in s1
+ case class M[A](in: State => Tuple2[A, State]) {
+ def bind[B](k: A => M[B]) = M[B]{ s0 =>
+ val (a, s1) = this in s0; k(a) in s1
}
def map[B](f: A => B): M[B] = bind(x => unitM(f(x)));
def flatMap[B](f: A => M[B]): M[B] = bind(f);
}
- def unitM[A](a: A) = M[A](s => Pair(a, s));
+ def unitM[A](a: A) = M[A](s => (a, s));
def showM(m: M[Value]): String = {
- val Pair(a, s1) = m in 0;
+ val (a, s1) = m in 0;
"Value: " + a + "; Count: " + s1
}
@@ -41,15 +41,15 @@ object stateInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => for (_ <- tickS) yield Num(m + n)
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => for (_ <- tickS) yield Num(m + n)
case _ => unitM(Wrong)
}
@@ -65,14 +65,14 @@ object stateInterpreter {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
}
- def test(t: Term): String =
+ def test(t: Term): String =
showM(interp(t, List()));
val term0 = App(Lam("x", Add(Var("x"), Var("x"))), Add(Con(10), Con(11)));
diff --git a/docs/examples/patterns.scala b/docs/examples/patterns.scala
index 738deabc66..d082fcc3de 100644
--- a/docs/examples/patterns.scala
+++ b/docs/examples/patterns.scala
@@ -13,17 +13,17 @@ object patterns {
case Leaf(x) => x
}
- def find[a,b](it: Iterator[Pair[a, b]], x: a): Option[b] = {
+ def find[a,b](it: Iterator[Tuple2[a, b]], x: a): Option[b] = {
var result: Option[b] = None
var found = false
while (it.hasNext && !found) {
- val Pair(x1, y) = it.next
+ val (x1, y) = it.next
if (x == x1) { found = true; result = Some(y) }
}
result
}
- def printFinds[a](xs: List[Pair[a, String]], x: a) =
+ def printFinds[a](xs: List[Tuple2[a, String]], x: a) =
find(xs.iterator, x) match {
case Some(y) => System.out.println(y)
case None => System.out.println("no match")
@@ -31,6 +31,6 @@ object patterns {
def main(args: Array[String]) {
println("sum of leafs=" + sumLeaves(tree1))
- printFinds(List(Pair(3, "three"), Pair(4, "four")), 4)
+ printFinds(List((3, "three"), (4, "four")), 4)
}
}
diff --git a/docs/examples/pilib/elasticBuffer.scala b/docs/examples/pilib/elasticBuffer.scala
index 5fec96ab6c..c173735dbb 100644
--- a/docs/examples/pilib/elasticBuffer.scala
+++ b/docs/examples/pilib/elasticBuffer.scala
@@ -8,7 +8,7 @@ object elasticBuffer {
* Recursive type for channels that carry a "String" channel and
* an object of the type we define.
*/
- class MetaChan extends Chan[Pair[Chan[String], MetaChan]]
+ class MetaChan extends Chan[Tuple2[Chan[String], MetaChan]]
def Buffer(put: Chan[String], get: Chan[String]): Unit = {
@@ -18,19 +18,19 @@ object elasticBuffer {
def Bl(i:Chan[String], l: MetaChan,
o: Chan[String], r: MetaChan): unit =
choice (
- l(Pair(o,r)) * (System.out.println("Removed one cell.")),
+ l((o,r)) * (System.out.println("Removed one cell.")),
i * (inp => Cl(i, l, o, r, inp))
)
/**
* A buffer cell containing a value, ready to receive (o,r) from the right.
*/
- def Cl(i: Chan[String], l: MetaChan,
+ def Cl(i: Chan[String], l: MetaChan,
o: Chan[String], r: MetaChan, content: String): Unit =
choice (
o(content) * (Bl(i,l,o,r)),
i * (inp => Dl(i,l,o,r,content, inp)),
- r * ( { case Pair(newo, newr) => Cl(i,l,newo,newr,content) })
+ r * ( { case (newo, newr) => Cl(i,l,newo,newr,content) })
)
/**
diff --git a/docs/examples/pilib/handover.scala b/docs/examples/pilib/handover.scala
index c9b6156c2c..4e9a5670a0 100644
--- a/docs/examples/pilib/handover.scala
+++ b/docs/examples/pilib/handover.scala
@@ -13,14 +13,14 @@ object handoverRecursive {
* Recursive type for channels that carry a channel "unit" and
* an object of the type we define.
*/
- class Switch extends Chan[Pair[Chan[unit], Switch]]
+ class Switch extends Chan[Tuple2[Chan[unit], Switch]]
/**
* Car.
*/
def Car(talk: Chan[unit], switch: Switch): unit =
choice (
- switch * ({ case Pair(t,s) => Car(t, s) }),
+ switch * ({ case (t,s) => Car(t, s) }),
talk(()) * ( {
Thread.sleep(1 + random.nextInt(1000));
System.out.println("Car emitted a message.");
@@ -32,20 +32,20 @@ object handoverRecursive {
* Control center.
*/
def Control(talk1: Chan[unit], switch1: Switch,
- gain1: Switch, lose1: Switch,
+ gain1: Switch, lose1: Switch,
talk2: Chan[unit], switch2: Switch,
gain2: Switch, lose2: Switch): unit
= {
def Control1: unit= {
Thread.sleep(1 + random.nextInt(1000));
- lose1.write(Pair(talk2, switch2));
- gain2.write(Pair(talk2, switch2));
+ lose1.write((talk2, switch2));
+ gain2.write((talk2, switch2));
Control2
}
def Control2: unit = {
Thread.sleep(1 + random.nextInt(1000));
- lose2.write(Pair(talk1, switch1));
- gain1.write(Pair(talk1, switch1));
+ lose2.write((talk1, switch1));
+ gain1.write((talk1, switch1));
Control1
}
Control1
@@ -62,8 +62,8 @@ object handoverRecursive {
System.out.println(id + " received a message.")
ActiveTransmitter(id, talk, switch, gain, lose)
}),
- lose * ({ case Pair(t, s) => {
- switch.write(Pair(t, s))
+ lose * ({ case (t, s) => {
+ switch.write((t, s))
IdleTransmitter(id, gain, lose)
}})
);
@@ -72,7 +72,7 @@ object handoverRecursive {
* Idle transmitter.
*/
def IdleTransmitter(id: String, gain: Switch, lose: Switch): unit = {
- val Pair(t, s) = gain.read;
+ val (t, s) = gain.read;
ActiveTransmitter(id, t, s, gain, lose)
}
@@ -108,7 +108,7 @@ object handoverCast {
def Car(talk: Chan[Any], switch: Chan[Any]): unit =
choice (
switch * (o => {
- val Pair(t,s) = o.asInstanceOf[Pair[Chan[Any],Chan[Any]]];
+ val (t,s) = o.asInstanceOf[Tuple2[Chan[Any],Chan[Any]]];
Car(t, s)
}),
talk(()) * ( {
@@ -122,20 +122,20 @@ object handoverCast {
* Control center.
*/
def Control(talk1: Chan[Any], switch1: Chan[Any],
- gain1: Chan[Any], lose1: Chan[Any],
+ gain1: Chan[Any], lose1: Chan[Any],
talk2: Chan[Any], switch2: Chan[Any],
gain2: Chan[Any], lose2: Chan[Any]): unit
= {
def Control1: unit = {
Thread.sleep(1 + random.nextInt(1000));
- lose1.write(Pair(talk2, switch2));
- gain2.write(Pair(talk2, switch2));
+ lose1.write((talk2, switch2));
+ gain2.write((talk2, switch2));
Control2
}
def Control2: unit = {
Thread.sleep(1 + random.nextInt(1000));
- lose2.write(Pair(talk1, switch1));
- gain1.write(Pair(talk1, switch1));
+ lose2.write((talk1, switch1));
+ gain1.write((talk1, switch1));
Control1
}
Control1
@@ -153,8 +153,8 @@ object handoverCast {
ActiveTransmitter(id, talk, switch, gain, lose)
}),
lose * (o => {
- val Pair(t, s) = o.asInstanceOf[Pair[Chan[Any],Chan[Any]]]
- switch.write(Pair(t, s))
+ val (t, s) = o.asInstanceOf[Tuple2[Chan[Any],Chan[Any]]]
+ switch.write((t, s))
IdleTransmitter(id, gain, lose)
})
)
@@ -163,7 +163,7 @@ object handoverCast {
* Idle transmitter.
*/
def IdleTransmitter(id: String, gain: Chan[Any], lose: Chan[Any]): unit = {
- val Pair(t, s) = gain.read.asInstanceOf[Pair[Chan[Any],Chan[Any]]]
+ val (t, s) = gain.read.asInstanceOf[Tuple2[Chan[Any],Chan[Any]]]
ActiveTransmitter(id, t, s, gain, lose)
}
diff --git a/docs/examples/pilib/piNat.scala b/docs/examples/pilib/piNat.scala
index a1a0e682e1..c6d9bdaf5c 100644
--- a/docs/examples/pilib/piNat.scala
+++ b/docs/examples/pilib/piNat.scala
@@ -4,23 +4,23 @@ import scala.concurrent.pilib._
/** Church encoding of naturals in the Pi-calculus */
object piNat extends Application {
-
+
/** Locations of Pi-calculus natural */
- class NatChan extends Chan[Triple[Chan[Unit], Chan[NatChan], Chan[NatChan]]]
+ class NatChan extends Chan[Tuple3[Chan[Unit], Chan[NatChan], Chan[NatChan]]]
/** Zero */
def Z(l: NatChan): Unit = choice (
- l * { case Triple(z, sd, d) => z.write(()) }
+ l * { case (z, sd, d) => z.write(()) }
)
/** Successor of Double */
def SD(n: NatChan, l: NatChan): Unit = choice (
- l * { case Triple(z, sd, d) => sd.write(n) }
+ l * { case (z, sd, d) => sd.write(n) }
)
/** Double */
def D(n: NatChan, l: NatChan): Unit = choice (
- l * { case Triple(z, sd, d) => d.write(n) }
+ l * { case (z, sd, d) => d.write(n) }
)
/** Make "l" a location representing the natural "n" */
@@ -34,7 +34,7 @@ object piNat extends Application {
val z = new Chan[Unit]
val sd = new Chan[NatChan]
val d = new Chan[NatChan]
- spawn < m.write(Triple(z, sd, d)) >;
+ spawn < m.write((z, sd, d)) >;
choice (
z * { x => make(1, n) },
sd * { m1 => { val n1 = new NatChan; spawn < D(n1, n) >; Succ(m1, n1) } },
@@ -47,7 +47,7 @@ object piNat extends Application {
val z = new Chan[Unit]
val sd = new Chan[NatChan]
val d = new Chan[NatChan]
- spawn < l.write(Triple(z, sd, d)) >;
+ spawn < l.write((z, sd, d)) >;
choice (
z * { x => spawn < Z(m) >; Z(n) },
sd * { l1 => { val m1 = new NatChan; val n1 = new NatChan;
@@ -64,7 +64,7 @@ object piNat extends Application {
val z = new Chan[Unit]
val sd = new Chan[NatChan]
val d = new Chan[NatChan]
- spawn < n.write(Triple(z, sd, d)) >;
+ spawn < n.write((z, sd, d)) >;
choice (
z * { x => 0 },
sd * { n1 => 2 * value(n1) + 1 },
diff --git a/docs/examples/typeinf.scala b/docs/examples/typeinf.scala
index d4bc8bf3e1..ac6cc35f6b 100644
--- a/docs/examples/typeinf.scala
+++ b/docs/examples/typeinf.scala
@@ -53,11 +53,11 @@ object typeInfer {
(emptySubst /: tyvars) ((s, tv) => s.extend(tv, newTyvar())) (tpe)
}
- type Env = List[Pair[String, TypeScheme]]
+ type Env = List[Tuple2[String, TypeScheme]]
def lookup(env: Env, x: String): TypeScheme = env match {
case List() => null
- case Pair(y, t) :: env1 => if (x == y) t else lookup(env1, x)
+ case (y, t) :: env1 => if (x == y) t else lookup(env1, x)
}
def gen(env: Env, t: Type): TypeScheme =
@@ -69,22 +69,22 @@ object typeInfer {
case Tycon(k, ts) => (List[Tyvar]() /: ts) ((tvs, t) => tvs union tyvars(t))
}
- def tyvars(ts: TypeScheme): List[Tyvar] =
+ def tyvars(ts: TypeScheme): List[Tyvar] =
tyvars(ts.tpe) diff ts.tyvars;
def tyvars(env: Env): List[Tyvar] =
(List[Tyvar]() /: env) ((tvs, nt) => tvs union tyvars(nt._2))
- def mgu(t: Type, u: Type, s: Subst): Subst = Pair(s(t), s(u)) match {
- case Pair(Tyvar(a), Tyvar(b)) if (a == b) =>
+ def mgu(t: Type, u: Type, s: Subst): Subst = (s(t), s(u)) match {
+ case (Tyvar(a), Tyvar(b)) if (a == b) =>
s
- case Pair(Tyvar(a), _) if !(tyvars(u) contains a) =>
+ case (Tyvar(a), _) if !(tyvars(u) contains a) =>
s.extend(Tyvar(a), u)
- case Pair(_, Tyvar(a)) =>
+ case (_, Tyvar(a)) =>
mgu(u, t, s)
- case Pair(Arrow(t1, t2), Arrow(u1, u2)) =>
+ case (Arrow(t1, t2), Arrow(u1, u2)) =>
mgu(t1, u1, mgu(t2, u2, s))
- case Pair(Tycon(k1, ts), Tycon(k2, us)) if (k1 == k2) =>
+ case (Tycon(k1, ts), Tycon(k2, us)) if (k1 == k2) =>
(s /: (ts zip us)) ((s, tu) => mgu(tu._1, tu._2, s))
case _ =>
throw new TypeError("cannot unify " + s(t) + " with " + s(u))
@@ -103,7 +103,7 @@ object typeInfer {
case Lam(x, e1) =>
val a, b = newTyvar()
val s1 = mgu(t, Arrow(a, b), s)
- val env1 = Pair(x, TypeScheme(List(), a)) :: env
+ val env1 = (x, TypeScheme(List(), a)) :: env
tp(env1, e1, b, s1)
case App(e1, e2) =>
@@ -114,7 +114,7 @@ object typeInfer {
case Let(x, e1, e2) =>
val a = newTyvar()
val s1 = tp(env, e1, a, s)
- tp(Pair(x, gen(env, s1(a))) :: env, e2, t, s1)
+ tp((x, gen(env, s1(a))) :: env, e2, t, s1)
}
}
var current: Term = null
@@ -134,18 +134,18 @@ object typeInfer {
private val a = typeInfer.newTyvar()
val env = List(
/*
- Pair("true", gen(booleanType)),
- Pair("false", gen(booleanType)),
- Pair("if", gen(Arrow(booleanType, Arrow(a, Arrow(a, a))))),
- Pair("zero", gen(intType)),
- Pair("succ", gen(Arrow(intType, intType))),
- Pair("nil", gen(listType(a))),
- Pair("cons", gen(Arrow(a, Arrow(listType(a), listType(a))))),
- Pair("isEmpty", gen(Arrow(listType(a), booleanType))),
- Pair("head", gen(Arrow(listType(a), a))),
- Pair("tail", gen(Arrow(listType(a), listType(a)))),
+ ("true", gen(booleanType)),
+ ("false", gen(booleanType)),
+ ("if", gen(Arrow(booleanType, Arrow(a, Arrow(a, a))))),
+ ("zero", gen(intType)),
+ ("succ", gen(Arrow(intType, intType))),
+ ("nil", gen(listType(a))),
+ ("cons", gen(Arrow(a, Arrow(listType(a), listType(a))))),
+ ("isEmpty", gen(Arrow(listType(a), booleanType))),
+ ("head", gen(Arrow(listType(a), a))),
+ ("tail", gen(Arrow(listType(a), listType(a)))),
*/
- Pair("fix", gen(Arrow(Arrow(a, a), a)))
+ ("fix", gen(Arrow(Arrow(a, a), a)))
)
}
@@ -181,7 +181,7 @@ object typeInfer {
yield Lam(x, t): Term )
|||
( for (
- letid <- id if letid == "let";
+ letid <- id if letid == "let";
x <- ident;
_ <- wschr('=');
t <- term;
@@ -220,7 +220,7 @@ object typeInfer {
val input = 0
def any = new Parser[char] {
def apply(in: int): Parser[char]#Result =
- if (in < s.length()) Some(Pair(s charAt in, in + 1)) else None
+ if (in < s.length()) Some((s charAt in, in + 1)) else None
}
}
@@ -239,7 +239,7 @@ object typeInfer {
if (args.length == 1) {
val ps = new ParseString(args(0)) with MiniMLParsers
ps.all(ps.input) match {
- case Some(Pair(term, _)) =>
+ case Some((term, _)) =>
"" + term + ": " + showType(term)
case None =>
"syntax error"
diff --git a/src/actors/scala/actors/Future.scala b/src/actors/scala/actors/Future.scala
index 9d123cb2d5..4421c7a07a 100644
--- a/src/actors/scala/actors/Future.scala
+++ b/src/actors/scala/actors/Future.scala
@@ -180,17 +180,17 @@ object Futures {
var cnt = 0
val mappedFts = fts.map(ft =>
- Pair({cnt+=1; cnt-1}, ft))
+ ({cnt+=1; cnt-1}, ft))
- val unsetFts = mappedFts.filter((p: Pair[Int, Future[Any]]) => {
+ val unsetFts = mappedFts.filter((p: Tuple2[Int, Future[Any]]) => {
if (p._2.isSet) { resultsMap(p._1) = Some(p._2()); false }
else { resultsMap(p._1) = None; true }
})
- val partFuns = unsetFts.map((p: Pair[Int, Future[Any]]) => {
+ val partFuns = unsetFts.map((p: Tuple2[Int, Future[Any]]) => {
val FutCh = p._2.inputChannel
- val singleCase: PartialFunction[Any, Pair[Int, Any]] = {
- case FutCh ! any => Pair(p._1, any)
+ val singleCase: PartialFunction[Any, Tuple2[Int, Any]] = {
+ case FutCh ! any => (p._1, any)
}
singleCase
})
@@ -201,7 +201,7 @@ object Futures {
}
Actor.timer.schedule(timerTask, timeout)
- def awaitWith(partFuns: Seq[PartialFunction[Any, Pair[Int, Any]]]) {
+ def awaitWith(partFuns: Seq[PartialFunction[Any, Tuple2[Int, Any]]]) {
val reaction: PartialFunction[Any, Unit] = new PartialFunction[Any, Unit] {
def isDefinedAt(msg: Any) = msg match {
case TIMEOUT => true
@@ -212,7 +212,7 @@ object Futures {
case _ => {
val pfOpt = partFuns find (_ isDefinedAt msg)
val pf = pfOpt.get // succeeds always
- val Pair(idx, subres) = pf(msg)
+ val (idx, subres) = pf(msg)
resultsMap(idx) = Some(subres)
val partFunsRest = partFuns filter (_ != pf)
diff --git a/src/actors/scala/actors/remote/NetKernel.scala b/src/actors/scala/actors/remote/NetKernel.scala
index 4795ff3eb6..57d7af6d26 100644
--- a/src/actors/scala/actors/remote/NetKernel.scala
+++ b/src/actors/scala/actors/remote/NetKernel.scala
@@ -43,8 +43,8 @@ private[remote] class NetKernel(service: Service) {
private val names = new mutable.HashMap[OutputChannel[Any], Symbol]
def register(name: Symbol, a: OutputChannel[Any]): Unit = synchronized {
- actors += Pair(name, a)
- names += Pair(a, name)
+ actors(name) = a
+ names(a) = name
}
def getOrCreateName(from: OutputChannel[Any]) = names.get(from) match {
@@ -79,7 +79,7 @@ private[remote] class NetKernel(service: Service) {
def createProxy(node: Node, sym: Symbol): Proxy = {
val p = new Proxy(node, sym, this)
- proxies += Pair((node, sym), p)
+ proxies((node, sym)) = p
p
}
@@ -99,7 +99,7 @@ private[remote] class NetKernel(service: Service) {
proxies.synchronized {
proxies.get((senderNode, senderName)) match {
case Some(senderProxy) => // do nothing
- case None => proxies += Pair((senderNode, senderName), p)
+ case None => proxies((senderNode, senderName)) = p
}
}
diff --git a/src/actors/scala/actors/remote/Proxy.scala b/src/actors/scala/actors/remote/Proxy.scala
index 43a43ac99c..9949b36181 100644
--- a/src/actors/scala/actors/remote/Proxy.scala
+++ b/src/actors/scala/actors/remote/Proxy.scala
@@ -142,7 +142,7 @@ private[remote] class DelegateActor(creator: Proxy, node: Node, name: Symbol, ke
// create a new reply channel...
val replyCh = new Channel[Any](this)
// ...that maps to session
- sessionMap += Pair(replyCh, session)
+ sessionMap(replyCh) = session
// local send
out.send(msg, replyCh)
@@ -178,7 +178,7 @@ private[remote] class DelegateActor(creator: Proxy, node: Node, name: Symbol, ke
// create fresh session ID...
val fresh = FreshNameCreator.newName(node+"@"+name)
// ...that maps to reply channel
- channelMap += Pair(fresh, sender)
+ channelMap(fresh) = sender
kernel.forward(sender, node, name, msg, fresh)
} else {
kernel.forward(sender, node, name, msg, 'nosession)
diff --git a/src/actors/scala/actors/remote/RemoteActor.scala b/src/actors/scala/actors/remote/RemoteActor.scala
index 799076a01f..2daf9ceb43 100644
--- a/src/actors/scala/actors/remote/RemoteActor.scala
+++ b/src/actors/scala/actors/remote/RemoteActor.scala
@@ -64,7 +64,7 @@ object RemoteActor {
val serv = TcpService(port, cl)
val kern = serv.kernel
val s = Actor.self(Scheduler)
- kernels += Pair(s, kern)
+ kernels(s) = kern
s.onTerminate {
Debug.info("alive actor "+s+" terminated")
@@ -90,7 +90,7 @@ object RemoteActor {
val kernel = kernels.get(Actor.self(Scheduler)) match {
case None =>
val serv = TcpService(TcpService.generatePort, cl)
- kernels += Pair(Actor.self(Scheduler), serv.kernel)
+ kernels(Actor.self(Scheduler)) = serv.kernel
serv.kernel
case Some(k) =>
k
diff --git a/src/actors/scala/actors/remote/TcpService.scala b/src/actors/scala/actors/remote/TcpService.scala
index 75e36b2738..69e5c46c52 100644
--- a/src/actors/scala/actors/remote/TcpService.scala
+++ b/src/actors/scala/actors/remote/TcpService.scala
@@ -35,7 +35,7 @@ object TcpService {
service
case None =>
val service = new TcpService(port, cl)
- ports += Pair(port, service)
+ ports(port) = service
service.start()
Debug.info("created service at "+service.node)
service
@@ -106,9 +106,9 @@ class TcpService(port: Int, cl: ClassLoader) extends Thread with Service {
// when remote net kernel comes up
(pendingSends.get(node): @unchecked) match {
case None =>
- pendingSends += Pair(node, List(data))
+ pendingSends(node) = List(data)
case Some(msgs) if msgs.length < TcpService.BufSize =>
- pendingSends += Pair(node, data :: msgs)
+ pendingSends(node) = data :: msgs
}
}
@@ -183,7 +183,7 @@ class TcpService(port: Int, cl: ClassLoader) extends Thread with Service {
new mutable.HashMap[Node, TcpServiceWorker]
private[actors] def addConnection(node: Node, worker: TcpServiceWorker) = synchronized {
- connections += Pair(node, worker)
+ connections(node) = worker
}
def getConnection(n: Node) = synchronized {
diff --git a/src/compiler/scala/reflect/macros/compiler/Resolvers.scala b/src/compiler/scala/reflect/macros/compiler/Resolvers.scala
index 03d306f593..e4851632a5 100644
--- a/src/compiler/scala/reflect/macros/compiler/Resolvers.scala
+++ b/src/compiler/scala/reflect/macros/compiler/Resolvers.scala
@@ -9,7 +9,7 @@ trait Resolvers {
import global._
import analyzer._
- import definitions.{EmptyPackageClass => _, _}
+ import definitions._
import treeInfo._
import gen._
private val runDefinitions = currentRun.runDefinitions
diff --git a/src/compiler/scala/tools/ant/ScalaTool.scala b/src/compiler/scala/tools/ant/ScalaTool.scala
index e7ac53c8fb..bb6a933d3f 100644
--- a/src/compiler/scala/tools/ant/ScalaTool.scala
+++ b/src/compiler/scala/tools/ant/ScalaTool.scala
@@ -139,7 +139,7 @@ class ScalaTool extends ScalaMatchingTask {
val st = s.trim
val stArray = st.split("=", 2)
if (stArray.length == 2) {
- if (input != "") List(Pair(stArray(0), stArray(1))) else Nil
+ if (input != "") List((stArray(0), stArray(1))) else Nil
}
else
buildError("Property " + st + " is not formatted properly.")
@@ -170,7 +170,7 @@ class ScalaTool extends ScalaMatchingTask {
private def getProperties: String =
properties.map({
- case Pair(name,value) => "-D" + name + "=\"" + value + "\""
+ case (name,value) => "-D" + name + "=\"" + value + "\""
}).mkString("", " ", "")
/*============================================================================*\
diff --git a/src/compiler/scala/tools/ant/sabbus/Compilers.scala b/src/compiler/scala/tools/ant/sabbus/Compilers.scala
index b1994233e8..a0aad49f20 100644
--- a/src/compiler/scala/tools/ant/sabbus/Compilers.scala
+++ b/src/compiler/scala/tools/ant/sabbus/Compilers.scala
@@ -27,7 +27,7 @@ object Compilers extends scala.collection.DefaultMap[String, Compiler] {
if (debug) println("Making compiler " + id)
if (debug) println(" memory before: " + freeMemoryString)
val comp = new Compiler(classpath, settings)
- container += Pair(id, comp)
+ container(id) = comp
if (debug) println(" memory after: " + freeMemoryString)
comp
}
diff --git a/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala b/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala
index 60f7857d0c..939641c3eb 100644
--- a/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala
+++ b/src/compiler/scala/tools/nsc/backend/icode/analysis/Liveness.scala
@@ -69,7 +69,7 @@ abstract class Liveness {
case STORE_LOCAL(local) if (!genSet(local)) => killSet = killSet + local
case _ => ()
}
- Pair(genSet, killSet)
+ (genSet, killSet)
}
override def run() {
diff --git a/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala b/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala
index 7a53293384..f10d7cdc40 100644
--- a/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala
+++ b/src/compiler/scala/tools/nsc/backend/icode/analysis/TypeFlowAnalysis.scala
@@ -418,7 +418,7 @@ abstract class TypeFlowAnalysis {
!blackballed(concreteMethod)
}
if(isCandidate) {
- remainingCALLs += Pair(cm, CallsiteInfo(b, receiver, result.stack.length, concreteMethod))
+ remainingCALLs(cm) = CallsiteInfo(b, receiver, result.stack.length, concreteMethod)
} else {
remainingCALLs.remove(cm)
isOnWatchlist.remove(cm)
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala
index c166b0bb7e..4f9f4c9e31 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeBodyBuilder.scala
@@ -741,13 +741,13 @@ abstract class BCodeBodyBuilder extends BCodeSkelBuilder {
var flatKeys: List[Int] = Nil
var targets: List[asm.Label] = Nil
var default: asm.Label = null
- var switchBlocks: List[Pair[asm.Label, Tree]] = Nil
+ var switchBlocks: List[Tuple2[asm.Label, Tree]] = Nil
// collect switch blocks and their keys, but don't emit yet any switch-block.
for (caze @ CaseDef(pat, guard, body) <- tree.cases) {
assert(guard == EmptyTree, guard)
val switchBlockPoint = new asm.Label
- switchBlocks ::= Pair(switchBlockPoint, body)
+ switchBlocks ::= (switchBlockPoint, body)
pat match {
case Literal(value) =>
flatKeys ::= value.intValue
@@ -772,7 +772,7 @@ abstract class BCodeBodyBuilder extends BCodeSkelBuilder {
// emit switch-blocks.
val postMatch = new asm.Label
for (sb <- switchBlocks.reverse) {
- val Pair(caseLabel, caseBody) = sb
+ val (caseLabel, caseBody) = sb
markProgramPoint(caseLabel)
genLoad(caseBody, generatedType)
bc goTo postMatch
@@ -790,7 +790,7 @@ abstract class BCodeBodyBuilder extends BCodeSkelBuilder {
genLoad(expr, expectedType)
val end = currProgramPoint()
if (emitVars) { // add entries to LocalVariableTable JVM attribute
- for (Pair(sym, start) <- varsInScope.reverse) { emitLocalVarScope(sym, start, end) }
+ for ((sym, start) <- varsInScope.reverse) { emitLocalVarScope(sym, start, end) }
}
varsInScope = savedScope
}
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala
index c22ced26a5..64ed094a47 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeHelpers.scala
@@ -112,7 +112,7 @@ abstract class BCodeHelpers extends BCodeTypes with BytecodeWriters {
val ta = exemplars.get(a)
val tb = exemplars.get(b)
- val res = Pair(ta.isInterface, tb.isInterface) match {
+ val res = (ta.isInterface, tb.isInterface) match {
case (true, true) =>
// exercised by test/files/run/t4761.scala
if (tb.isSubtypeOf(ta.c)) ta.c
@@ -759,7 +759,7 @@ abstract class BCodeHelpers extends BCodeTypes with BytecodeWriters {
def emitParamAnnotations(jmethod: asm.MethodVisitor, pannotss: List[List[AnnotationInfo]]) {
val annotationss = pannotss map (_ filter shouldEmitAnnotation)
if (annotationss forall (_.isEmpty)) return
- for (Pair(annots, idx) <- annotationss.zipWithIndex;
+ for ((annots, idx) <- annotationss.zipWithIndex;
annot <- annots) {
val AnnotationInfo(typ, args, assocs) = annot
assert(args.isEmpty, args)
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala
index 5fe03624cf..c921d11d00 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeSkelBuilder.scala
@@ -436,7 +436,7 @@ abstract class BCodeSkelBuilder extends BCodeHelpers {
var labelDef: scala.collection.Map[Symbol, LabelDef] = null// (LabelDef-sym -> LabelDef)
// bookkeeping the scopes of non-synthetic local vars, to emit debug info (`emitVars`).
- var varsInScope: List[Pair[Symbol, asm.Label]] = null // (local-var-sym -> start-of-scope)
+ var varsInScope: List[Tuple2[Symbol, asm.Label]] = null // (local-var-sym -> start-of-scope)
// helpers around program-points.
def lastInsn: asm.tree.AbstractInsnNode = {
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala b/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala
index 916d118b6e..5be5abd895 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/BCodeTypes.scala
@@ -90,11 +90,11 @@ abstract class BCodeTypes extends BCodeIdiomatic {
)
boxResultType =
- for(Pair(csym, msym) <- currentRun.runDefinitions.boxMethod)
+ for((csym, msym) <- currentRun.runDefinitions.boxMethod)
yield (msym -> classLiteral(primitiveTypeMap(csym)))
unboxResultType =
- for(Pair(csym, msym) <- currentRun.runDefinitions.unboxMethod)
+ for((csym, msym) <- currentRun.runDefinitions.unboxMethod)
yield (msym -> primitiveTypeMap(csym))
// boxed classes are looked up in the `exemplars` map by jvmWiseLUB().
diff --git a/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala b/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala
index 5e885fdd04..e92f8c2541 100644
--- a/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala
+++ b/src/compiler/scala/tools/nsc/backend/jvm/GenASM.scala
@@ -293,7 +293,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
def inameToSymbol(iname: String): Symbol = {
val name = global.newTypeName(iname)
val res0 =
- if (nme.isModuleName(name)) rootMirror.getModule(name.dropModule)
+ if (nme.isModuleName(name)) rootMirror.getModuleByName(name.dropModule)
else rootMirror.getClassByName(name.replace('/', '.')) // TODO fails for inner classes (but this hasn't been tested).
assert(res0 != NoSymbol)
val res = jsymbol(res0)
@@ -335,7 +335,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
assert(a.isClass)
assert(b.isClass)
- val res = Pair(a.isInterface, b.isInterface) match {
+ val res = (a.isInterface, b.isInterface) match {
case (true, true) =>
global.lub(List(a.tpe, b.tpe)).typeSymbol // TODO assert == firstCommonSuffix of resp. parents
case (true, false) =>
@@ -1014,7 +1014,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
def emitParamAnnotations(jmethod: asm.MethodVisitor, pannotss: List[List[AnnotationInfo]]) {
val annotationss = pannotss map (_ filter shouldEmitAnnotation)
if (annotationss forall (_.isEmpty)) return
- for (Pair(annots, idx) <- annotationss.zipWithIndex;
+ for ((annots, idx) <- annotationss.zipWithIndex;
annot <- annots) {
val AnnotationInfo(typ, args, assocs) = annot
assert(args.isEmpty, args)
@@ -2156,7 +2156,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
def getMerged(): scala.collection.Map[Local, List[Interval]] = {
// TODO should but isn't: unbalanced start(s) of scope(s)
- val shouldBeEmpty = pending filter { p => val Pair(_, st) = p; st.nonEmpty }
+ val shouldBeEmpty = pending filter { p => val (_, st) = p; st.nonEmpty }
val merged = mutable.Map[Local, List[Interval]]()
def addToMerged(lv: Local, start: Label, end: Label) {
val intv = Interval(start, end)
@@ -2169,7 +2169,7 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
(b) take the latest end (onePastLast if none available)
(c) merge the thus made-up interval
*/
- for(Pair(k, st) <- shouldBeEmpty) {
+ for((k, st) <- shouldBeEmpty) {
var start = st.toList.sortBy(_.getOffset).head
if(merged.isDefinedAt(k)) {
val balancedStart = merged(k).head.lstart
@@ -2206,25 +2206,25 @@ abstract class GenASM extends SubComponent with BytecodeWriters with GenJVMASM {
}
// adding non-param locals
var anonCounter = 0
- var fltnd: List[Triple[String, Local, Interval]] = Nil
- for(Pair(local, ranges) <- scoping.getMerged()) {
+ var fltnd: List[Tuple3[String, Local, Interval]] = Nil
+ for((local, ranges) <- scoping.getMerged()) {
var name = javaName(local.sym)
if (name == null) {
anonCounter += 1
name = "<anon" + anonCounter + ">"
}
for(intrvl <- ranges) {
- fltnd ::= Triple(name, local, intrvl)
+ fltnd ::= (name, local, intrvl)
}
}
// quest for deterministic output that Map.toList doesn't provide (so that ant test.stability doesn't complain).
val srtd = fltnd.sortBy { kr =>
- val Triple(name: String, _, intrvl: Interval) = kr
+ val (name: String, _, intrvl: Interval) = kr
- Triple(intrvl.start, intrvl.end - intrvl.start, name) // ie sort by (start, length, name)
+ (intrvl.start, intrvl.end - intrvl.start, name) // ie sort by (start, length, name)
}
- for(Triple(name, local, Interval(start, end)) <- srtd) {
+ for((name, local, Interval(start, end)) <- srtd) {
jmethod.visitLocalVariable(name, descriptor(local.kind), null, start, end, indexOf(local))
}
// "There may be no more than one LocalVariableTable attribute per local variable in the Code attribute"
diff --git a/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala b/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala
index 0cfcea87f8..0f317422ac 100644
--- a/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala
+++ b/src/compiler/scala/tools/nsc/backend/opt/DeadCodeElimination.scala
@@ -119,7 +119,7 @@ abstract class DeadCodeElimination extends SubComponent {
m foreachBlock { bb =>
useful(bb) = new mutable.BitSet(bb.size)
var rd = rdef.in(bb)
- for (Pair(i, idx) <- bb.toList.zipWithIndex) {
+ for ((i, idx) <- bb.toList.zipWithIndex) {
// utility for adding to worklist
def moveToWorkList() = moveToWorkListIf(cond = true)
@@ -137,7 +137,7 @@ abstract class DeadCodeElimination extends SubComponent {
i match {
case LOAD_LOCAL(_) =>
- defs = defs + Pair(((bb, idx)), rd.vars)
+ defs = defs + (((bb, idx), rd.vars))
moveToWorkListIf(cond = false)
case STORE_LOCAL(l) =>
@@ -350,7 +350,7 @@ abstract class DeadCodeElimination extends SubComponent {
val oldInstr = bb.toList
bb.open()
bb.clear()
- for (Pair(i, idx) <- oldInstr.zipWithIndex) {
+ for ((i, idx) <- oldInstr.zipWithIndex) {
if (useful(bb)(idx)) {
debuglog(" * " + i + " is useful")
bb.emit(i, i.pos)
diff --git a/src/compiler/scala/tools/nsc/plugins/Plugin.scala b/src/compiler/scala/tools/nsc/plugins/Plugin.scala
index 1578caff26..d194c095f8 100644
--- a/src/compiler/scala/tools/nsc/plugins/Plugin.scala
+++ b/src/compiler/scala/tools/nsc/plugins/Plugin.scala
@@ -144,7 +144,7 @@ object Plugin {
// (j, Try(descriptor))
def required(j: Path) = j -> loadDescriptionFromJar(j)
- type Paired = Pair[Path, Try[PluginDescription]]
+ type Paired = Tuple2[Path, Try[PluginDescription]]
val included: List[Paired] = (dirs flatMap (_ ifDirectory scan)).flatten
val exploded: List[Paired] = jars flatMap (_ ifDirectory explode)
val explicit: List[Paired] = jars flatMap (_ ifFile required)
diff --git a/src/compiler/scala/tools/nsc/reporters/Reporter.scala b/src/compiler/scala/tools/nsc/reporters/Reporter.scala
index 0544da5d3c..68362c066d 100644
--- a/src/compiler/scala/tools/nsc/reporters/Reporter.scala
+++ b/src/compiler/scala/tools/nsc/reporters/Reporter.scala
@@ -80,10 +80,4 @@ abstract class Reporter {
WARNING.count = 0
cancelled = false
}
-
- // sbt compat
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- def countElementsAsString(n: Int, elements: String): String = StringOps.countElementsAsString(n, elements)
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- def countAsString(n: Int): String = StringOps.countAsString(n)
}
diff --git a/src/compiler/scala/tools/nsc/scratchpad/Mixer.scala b/src/compiler/scala/tools/nsc/scratchpad/Mixer.scala
deleted file mode 100644
index 3aecc06b1e..0000000000
--- a/src/compiler/scala/tools/nsc/scratchpad/Mixer.scala
+++ /dev/null
@@ -1,99 +0,0 @@
-package scala.tools.nsc.scratchpad
-
-import java.io.{FileInputStream, InputStreamReader, IOException}
-
-import scala.collection.mutable.ArrayBuffer
-
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-class Mixer {
-
- protected val stdSeparator = "//> "
- protected val ctdSeparator = "//| "
- protected val sepColumn = 50
- protected val tabInc = 8
-
- type Comments = Seq[(Int, Array[Char])]
-
- def parseComments(comments: Array[Char]): Iterator[(Int, Array[Char])] = new Iterator[(Int, Array[Char])] {
- var idx = 0
- def hasNext = idx < comments.length
- def next() = {
- val nextSpace = comments indexOf (' ', idx)
- var nextNL = comments indexOf ('\n', nextSpace + 1)
- if (nextNL < 0) nextNL = comments.length
- val result =
- (new String(comments.slice(idx, nextSpace)).toInt, comments.slice(nextSpace + 1, nextNL))
- idx = nextNL + 1
- result
- }
- }
-
- def mix(source: Array[Char], comments: Array[Char]): Array[Char] = {
- val mixed = new ArrayBuffer[Char]
- var written = 0
- def align() = {
- var idx = mixed.lastIndexOf('\n') + 1
- var col = 0
- while (idx < mixed.length) {
- col =
- if (mixed(idx) == '\t') (col / tabInc) * tabInc + tabInc
- else col + 1
- idx += 1
- }
- if (col > sepColumn) {
- mixed += '\n'
- col = 0
- }
- while (col < sepColumn) {
- mixed += ' '
- col += 1
- }
- }
- for ((offset, cs) <- parseComments(comments)) {
- val sep =
- if (written < offset) {
- for (i <- written until offset) mixed += source(i)
- written = offset
- stdSeparator
- } else {
- mixed += '\n'
- ctdSeparator
- }
- align()
- mixed ++= sep ++= cs
- }
- mixed ++= source.view(written, source.length)
- mixed.toArray
- }
-
-}
-
-object Mixer extends Mixer {
-
- def contents(name: String): Array[Char] = {
- val page = new Array[Char](2 << 14)
- val buf = new ArrayBuffer[Char]
- val in = new FileInputStream(name)
- val rdr = new InputStreamReader(in)
- var nread = 0
- do {
- nread = rdr.read(page, 0, page.length)
- buf ++= (if (nread == page.length) page else page.take(nread))
- } while (nread >= 0)
- buf.toArray
- }
-
- def main(args: Array[String]) {
- val mixer = new Mixer
- try {
- require(args.length == 2, "required arguments: file1 file2")
- val source = contents(args(0))
- val comments = contents(args(1))
- val mixed = mixer.mix(source, comments)
- println(mixed.mkString)
- } catch {
- case ex: IOException =>
- println("error: "+ ex.getMessage)
- }
- }
-}
diff --git a/src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala b/src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala
deleted file mode 100644
index 61c1717fea..0000000000
--- a/src/compiler/scala/tools/nsc/scratchpad/SourceInserter.scala
+++ /dev/null
@@ -1,21 +0,0 @@
-package scala.tools.nsc
-package scratchpad
-
-import scala.reflect.internal.Chars._
-
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-object SourceInserter {
- def stripRight(cs: Array[Char]): Array[Char] = {
- val lines =
- new String(cs) split "\n"
- def leftPart(str: String) =
- (str split """//>|//\|""").head
- def isContinuation(str: String) =
- ((str contains "//>") || (str contains "//|")) && (leftPart(str) forall isWhitespace)
- def stripTrailingWS(str: String) =
- str take (str lastIndexWhere (!isWhitespace(_))) + 1
- val prefixes =
- lines filterNot isContinuation map leftPart map stripTrailingWS
- (prefixes mkString "\n").toArray
- }
-}
diff --git a/src/compiler/scala/tools/nsc/typechecker/Typers.scala b/src/compiler/scala/tools/nsc/typechecker/Typers.scala
index fa704adde2..8594309818 100644
--- a/src/compiler/scala/tools/nsc/typechecker/Typers.scala
+++ b/src/compiler/scala/tools/nsc/typechecker/Typers.scala
@@ -5051,7 +5051,7 @@ trait Typers extends Adaptations with Tags with TypersTracking with PatternTyper
// @M: fun is typed in TAPPmode because it is being applied to its actual type parameters
val fun1 = typed(fun, mode.forFunMode | TAPPmode)
- val tparams = fun1.symbol.typeParams
+ val tparams = if (fun1.symbol == null) Nil else fun1.symbol.typeParams
//@M TODO: val undets_fun = context.undetparams ?
// "do args first" (by restoring the context.undetparams) in order to maintain context.undetparams on the function side.
diff --git a/src/compiler/scala/tools/nsc/util/package.scala b/src/compiler/scala/tools/nsc/util/package.scala
index cb46004174..4237f36ade 100644
--- a/src/compiler/scala/tools/nsc/util/package.scala
+++ b/src/compiler/scala/tools/nsc/util/package.scala
@@ -90,51 +90,22 @@ package object util {
lazy val trace = new SimpleTracer(System.out)
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- val StringOps = scala.reflect.internal.util.StringOps
-
- @deprecated("Moved to scala.reflect.internal.util.StringOps", "2.10.0")
- type StringOps = scala.reflect.internal.util.StringOps
-
- @deprecated("scala.reflect.internal.util.WeakHashSet", "2.10.0")
- type WeakHashSet[T <: AnyRef] = scala.reflect.internal.util.WeakHashSet[T]
-
- @deprecated("Moved to scala.reflect.internal.util.Position", "2.10.0")
- val Position = scala.reflect.internal.util.Position
-
+ // These four deprecated since 2.10.0 are still used in (at least)
+ // the sbt 0.12.4 compiler interface.
@deprecated("Moved to scala.reflect.internal.util.Position", "2.10.0")
type Position = scala.reflect.internal.util.Position
-
@deprecated("Moved to scala.reflect.internal.util.NoPosition", "2.10.0")
val NoPosition = scala.reflect.internal.util.NoPosition
-
@deprecated("Moved to scala.reflect.internal.util.FakePos", "2.10.0")
val FakePos = scala.reflect.internal.util.FakePos
-
@deprecated("Moved to scala.reflect.internal.util.FakePos", "2.10.0")
type FakePos = scala.reflect.internal.util.FakePos
- @deprecated("Moved to scala.reflect.internal.util.OffsetPosition", "2.10.0")
- type OffsetPosition = scala.reflect.internal.util.OffsetPosition
-
+ // These three were still used in scala-refactoring.
@deprecated("Moved to scala.reflect.internal.util.RangePosition", "2.10.0")
type RangePosition = scala.reflect.internal.util.RangePosition
-
@deprecated("Moved to scala.reflect.internal.util.SourceFile", "2.10.0")
type SourceFile = scala.reflect.internal.util.SourceFile
-
- @deprecated("Moved to scala.reflect.internal.util.NoSourceFile", "2.10.0")
- val NoSourceFile = scala.reflect.internal.util.NoSourceFile
-
- @deprecated("Moved to scala.reflect.internal.util.NoFile", "2.10.0")
- val NoFile = scala.reflect.internal.util.NoFile
-
- @deprecated("Moved to scala.reflect.internal.util.ScriptSourceFile", "2.10.0")
- val ScriptSourceFile = scala.reflect.internal.util.ScriptSourceFile
-
- @deprecated("Moved to scala.reflect.internal.util.ScriptSourceFile", "2.10.0")
- type ScriptSourceFile = scala.reflect.internal.util.ScriptSourceFile
-
@deprecated("Moved to scala.reflect.internal.util.BatchSourceFile", "2.10.0")
type BatchSourceFile = scala.reflect.internal.util.BatchSourceFile
diff --git a/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala b/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala
index 3901184c25..126c14ac81 100644
--- a/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala
+++ b/src/compiler/scala/tools/reflect/quasiquotes/Parsers.scala
@@ -55,9 +55,7 @@ trait Parsers { self: Quasiquotes =>
def isHole(name: Name): Boolean = holeMap.contains(name)
- override implicit def fresh: FreshNameCreator = new FreshNameCreator {
- override def newName(prefix: String) = super.newName(nme.QUASIQUOTE_PREFIX + prefix)
- }
+ override implicit def fresh: FreshNameCreator = new FreshNameCreator(nme.QUASIQUOTE_PREFIX)
override val treeBuilder = new ParserTreeBuilder {
override implicit def fresh: FreshNameCreator = parser.fresh
@@ -189,19 +187,5 @@ trait Parsers { self: Quasiquotes =>
}
}
- // Extractor that matches names which were generated by call to
- // freshTermName or freshTypeName within quasiquotes. Such names
- // have qq$some$random$prefix$0 shape where qq$ part is added
- // by modified fresh name creator in QuasiquoteParser.
- object FreshName {
- def unapply(name: Name): Option[String] =
- name.toString.split("\\$").toSeq match {
- case qq +: (middle :+ last)
- if qq + "$" == nme.QUASIQUOTE_PREFIX
- && Try(last.toInt).isSuccess && middle.nonEmpty =>
- Some(middle.mkString("", "$", "$"))
- case _ =>
- None
- }
- }
+ object FreshName extends FreshNameExtractor(nme.QUASIQUOTE_PREFIX)
} \ No newline at end of file
diff --git a/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala b/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala
index d036a6e853..69cae24808 100644
--- a/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala
+++ b/src/interactive/scala/tools/nsc/interactive/CompilerControl.scala
@@ -62,17 +62,6 @@ trait CompilerControl { self: Global =>
def onUnitOf[T](source: SourceFile)(op: RichCompilationUnit => T): T =
op(unitOfFile.getOrElse(source.file, new RichCompilationUnit(source)))
- /** The compilation unit corresponding to a source file
- * if it does not yet exist create a new one atomically
- * Note: We want to get roid of this operation as it messes compiler invariants.
- */
- @deprecated("use getUnitOf(s) or onUnitOf(s) instead", "2.10.0")
- def unitOf(s: SourceFile): RichCompilationUnit = getOrCreateUnitOf(s)
-
- /** The compilation unit corresponding to a position */
- @deprecated("use getUnitOf(pos.source) or onUnitOf(pos.source) instead", "2.10.0")
- def unitOf(pos: Position): RichCompilationUnit = getOrCreateUnitOf(pos.source)
-
/** Removes the CompilationUnit corresponding to the given SourceFile
* from consideration for recompilation.
*/
@@ -229,18 +218,6 @@ trait CompilerControl { self: Global =>
def askParsedEntered(source: SourceFile, keepLoaded: Boolean, response: Response[Tree]) =
postWorkItem(new AskParsedEnteredItem(source, keepLoaded, response))
- /** Set sync var `response` to a pair consisting of
- * - the fully qualified name of the first top-level object definition in the file.
- * or "" if there are no object definitions.
- * - the text of the instrumented program which, when run,
- * prints its output and all defined values in a comment column.
- *
- * @param source The source file to be analyzed
- * @param response The response.
- */
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def askInstrumented(source: SourceFile, line: Int, response: Response[(String, Array[Char])]) =
- postWorkItem(new AskInstrumentedItem(source, line, response))
/** Cancels current compiler run and start a fresh one where everything will be re-typechecked
* (but not re-loaded).
@@ -250,11 +227,6 @@ trait CompilerControl { self: Global =>
/** Tells the compile server to shutdown, and not to restart again */
def askShutdown() = scheduler raise ShutdownReq
- @deprecated("use parseTree(source) instead", "2.10.0") // deleted 2nd parameter, as this has to run on 2.8 also.
- def askParse(source: SourceFile, response: Response[Tree]) = respond(response) {
- parseTree(source)
- }
-
/** Returns parse tree for source `source`. No symbols are entered. Syntax errors are reported.
*
* This method is thread-safe and as such can safely run outside of the presentation
@@ -419,15 +391,6 @@ trait CompilerControl { self: Global =>
response raise new MissingResponse
}
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- case class AskInstrumentedItem(source: SourceFile, line: Int, response: Response[(String, Array[Char])]) extends WorkItem {
- def apply() = self.getInstrumented(source, line, response)
- override def toString = "getInstrumented "+source
-
- def raiseMissing() =
- response raise new MissingResponse
- }
-
/** A do-nothing work scheduler that responds immediately with MissingResponse.
*
* Used during compiler shutdown.
diff --git a/src/interactive/scala/tools/nsc/interactive/Global.scala b/src/interactive/scala/tools/nsc/interactive/Global.scala
index da838e0f83..441398e443 100644
--- a/src/interactive/scala/tools/nsc/interactive/Global.scala
+++ b/src/interactive/scala/tools/nsc/interactive/Global.scala
@@ -18,6 +18,7 @@ import symtab.Flags.{ACCESSOR, PARAMACCESSOR}
import scala.annotation.{ elidable, tailrec }
import scala.language.implicitConversions
import scala.tools.nsc.typechecker.Typers
+import scala.util.control.Breaks._
/**
* This trait allows the IDE to have an instance of the PC that
@@ -100,7 +101,6 @@ class Global(settings: Settings, _reporter: Reporter, projectName: String = "")
with CompilerControl
with ContextTrees
with RichCompilationUnits
- with ScratchPadMaker
with Picklers {
import definitions._
@@ -406,85 +406,91 @@ class Global(settings: Settings, _reporter: Reporter, projectName: String = "")
*
*/
private[interactive] def pollForWork(pos: Position) {
- if (!interruptsEnabled) return
- if (pos == NoPosition || nodesSeen % yieldPeriod == 0)
- Thread.`yield`()
-
- def nodeWithWork(): Option[WorkEvent] =
- if (scheduler.moreWork || pendingResponse.isCancelled) Some(new WorkEvent(nodesSeen, System.currentTimeMillis))
- else None
-
- nodesSeen += 1
- logreplay("atnode", nodeWithWork()) match {
- case Some(WorkEvent(id, _)) =>
- debugLog("some work at node "+id+" current = "+nodesSeen)
-// assert(id >= nodesSeen)
- moreWorkAtNode = id
- case None =>
- }
+ var loop: Boolean = true
+ while (loop) {
+ breakable{
+ loop = false
+ if (!interruptsEnabled) return
+ if (pos == NoPosition || nodesSeen % yieldPeriod == 0)
+ Thread.`yield`()
+
+ def nodeWithWork(): Option[WorkEvent] =
+ if (scheduler.moreWork || pendingResponse.isCancelled) Some(new WorkEvent(nodesSeen, System.currentTimeMillis))
+ else None
+
+ nodesSeen += 1
+ logreplay("atnode", nodeWithWork()) match {
+ case Some(WorkEvent(id, _)) =>
+ debugLog("some work at node "+id+" current = "+nodesSeen)
+ // assert(id >= nodesSeen)
+ moreWorkAtNode = id
+ case None =>
+ }
- if (nodesSeen >= moreWorkAtNode) {
-
- logreplay("asked", scheduler.pollInterrupt()) match {
- case Some(ir) =>
- try {
- interruptsEnabled = false
- debugLog("ask started"+timeStep)
- ir.execute()
- } finally {
- debugLog("ask finished"+timeStep)
- interruptsEnabled = true
+ if (nodesSeen >= moreWorkAtNode) {
+
+ logreplay("asked", scheduler.pollInterrupt()) match {
+ case Some(ir) =>
+ try {
+ interruptsEnabled = false
+ debugLog("ask started"+timeStep)
+ ir.execute()
+ } finally {
+ debugLog("ask finished"+timeStep)
+ interruptsEnabled = true
+ }
+ loop = true; break
+ case _ =>
}
- pollForWork(pos)
- case _ =>
- }
-
- if (logreplay("cancelled", pendingResponse.isCancelled)) {
- throw CancelException
- }
-
- logreplay("exception thrown", scheduler.pollThrowable()) match {
- case Some(ex: FreshRunReq) =>
- newTyperRun()
- minRunId = currentRunId
- demandNewCompilerRun()
-
- case Some(ShutdownReq) =>
- scheduler.synchronized { // lock the work queue so no more items are posted while we clean it up
- val units = scheduler.dequeueAll {
- case item: WorkItem => Some(item.raiseMissing())
- case _ => Some(())
- }
-
- // don't forget to service interrupt requests
- scheduler.dequeueAllInterrupts(_.execute())
-
- debugLog("ShutdownReq: cleaning work queue (%d items)".format(units.size))
- debugLog("Cleanup up responses (%d loadedType pending, %d parsedEntered pending)"
- .format(waitLoadedTypeResponses.size, getParsedEnteredResponses.size))
- checkNoResponsesOutstanding()
- log.flush()
- scheduler = new NoWorkScheduler
- throw ShutdownReq
+ if (logreplay("cancelled", pendingResponse.isCancelled)) {
+ throw CancelException
}
- case Some(ex: Throwable) => log.flush(); throw ex
- case _ =>
- }
-
- lastWasReload = false
+ logreplay("exception thrown", scheduler.pollThrowable()) match {
+ case Some(ex: FreshRunReq) =>
+ newTyperRun()
+ minRunId = currentRunId
+ demandNewCompilerRun()
+
+ case Some(ShutdownReq) =>
+ scheduler.synchronized { // lock the work queue so no more items are posted while we clean it up
+ val units = scheduler.dequeueAll {
+ case item: WorkItem => Some(item.raiseMissing())
+ case _ => Some(())
+ }
+
+ // don't forget to service interrupt requests
+ scheduler.dequeueAllInterrupts(_.execute())
+
+ debugLog("ShutdownReq: cleaning work queue (%d items)".format(units.size))
+ debugLog("Cleanup up responses (%d loadedType pending, %d parsedEntered pending)"
+ .format(waitLoadedTypeResponses.size, getParsedEnteredResponses.size))
+ checkNoResponsesOutstanding()
+
+ log.flush()
+ scheduler = new NoWorkScheduler
+ throw ShutdownReq
+ }
+
+ case Some(ex: Throwable) => log.flush(); throw ex
+ case _ =>
+ }
- logreplay("workitem", scheduler.nextWorkItem()) match {
- case Some(action) =>
- try {
- debugLog("picked up work item at "+pos+": "+action+timeStep)
- action()
- debugLog("done with work item: "+action)
- } finally {
- debugLog("quitting work item: "+action+timeStep)
+ lastWasReload = false
+
+ logreplay("workitem", scheduler.nextWorkItem()) match {
+ case Some(action) =>
+ try {
+ debugLog("picked up work item at "+pos+": "+action+timeStep)
+ action()
+ debugLog("done with work item: "+action)
+ } finally {
+ debugLog("quitting work item: "+action+timeStep)
+ }
+ case None =>
}
- case None =>
+ }
}
}
}
@@ -1171,18 +1177,6 @@ class Global(settings: Settings, _reporter: Reporter, projectName: String = "")
}
}
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def getInstrumented(source: SourceFile, line: Int, response: Response[(String, Array[Char])]) {
- try {
- interruptsEnabled = false
- respond(response) {
- instrument(source, line)
- }
- } finally {
- interruptsEnabled = true
- }
- }
-
// ---------------- Helper classes ---------------------------
/** The typer run */
diff --git a/src/interactive/scala/tools/nsc/interactive/REPL.scala b/src/interactive/scala/tools/nsc/interactive/REPL.scala
index 33981771ec..8e9b0ceee0 100644
--- a/src/interactive/scala/tools/nsc/interactive/REPL.scala
+++ b/src/interactive/scala/tools/nsc/interactive/REPL.scala
@@ -9,7 +9,6 @@ package interactive
import scala.reflect.internal.util._
import scala.tools.nsc.reporters._
import scala.tools.nsc.io._
-import scala.tools.nsc.scratchpad.SourceInserter
import java.io.FileWriter
/** Interface of interactive compiler to a client such as an IDE
@@ -89,8 +88,6 @@ object REPL {
val completeResult = new Response[List[comp.Member]]
val typedResult = new Response[comp.Tree]
val structureResult = new Response[comp.Tree]
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- val instrumentedResult = new Response[(String, Array[Char])]
def makePos(file: String, off1: String, off2: String) = {
val source = toSourceFile(file)
@@ -112,52 +109,6 @@ object REPL {
show(structureResult)
}
- /** Write instrumented source file to disk.
- * @param iFullName The full name of the first top-level object in source
- * @param iContents An Array[Char] containing the instrumented source
- * @return The name of the instrumented source file
- */
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def writeInstrumented(iFullName: String, suffix: String, iContents: Array[Char]): String = {
- val iSimpleName = iFullName drop ((iFullName lastIndexOf '.') + 1)
- val iSourceName = iSimpleName + suffix
- val ifile = new FileWriter(iSourceName)
- ifile.write(iContents)
- ifile.close()
- iSourceName
- }
-
- /** The method for implementing worksheet functionality.
- * @param arguments a file name, followed by optional command line arguments that are passed
- * to the compiler that processes the instrumented source.
- * @param line A line number that controls uop to which line results should be produced
- * If line = -1, results are produced for all expressions in the worksheet.
- * @return The generated file content containing original source in the left column
- * and outputs in the right column, or None if the presentation compiler
- * does not respond to askInstrumented.
- */
- @deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
- def instrument(arguments: List[String], line: Int): Option[(String, String)] = {
- val source = toSourceFile(arguments.head)
- // strip right hand side comment column and any trailing spaces from all lines
- val strippedContents = SourceInserter.stripRight(source.content)
- val strippedSource = new BatchSourceFile(source.file, strippedContents)
- println("stripped source = "+strippedSource+":"+strippedContents.mkString)
- comp.askReload(List(strippedSource), reloadResult)
- comp.askInstrumented(strippedSource, line, instrumentedResult)
- using(instrumentedResult) {
- case (iFullName, iContents) =>
- println(s"instrumented source $iFullName = ${iContents.mkString}")
- val iSourceName = writeInstrumented(iFullName, "$instrumented.scala", iContents)
- val sSourceName = writeInstrumented(iFullName, "$stripped.scala", strippedContents)
- (iSourceName, sSourceName)
-/*
- * val vdirOpt = compileInstrumented(iSourceName, arguments.tail)
- runInstrumented(vdirOpt, iFullName, strippedSource.content)
- */
- }
- }
-
loop { line =>
(line split " ").toList match {
case "reload" :: args =>
@@ -177,10 +128,6 @@ object REPL {
doComplete(makePos(file, off1, off2))
case List("complete", file, off1) =>
doComplete(makePos(file, off1, off1))
- case "instrument" :: arguments =>
- println(instrument(arguments, -1))
- case "instrumentTo" :: line :: arguments =>
- println(instrument(arguments, line.toInt))
case List("quit") =>
comp.askShutdown()
sys.exit(1)
@@ -195,8 +142,6 @@ object REPL {
| typeat <file> <pos>
| complete <file> <start-pos> <end-pos>
| compile <file> <pos>
- | instrument <file> <arg>*
- | instrumentTo <line-num> <file> <arg>*
| structure <file>
| quit
|""".stripMargin)
diff --git a/src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala b/src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala
deleted file mode 100644
index 2400b97d97..0000000000
--- a/src/interactive/scala/tools/nsc/interactive/ScratchPadMaker.scala
+++ /dev/null
@@ -1,201 +0,0 @@
-package scala
-package tools.nsc
-package interactive
-
-import scala.reflect.internal.util.{SourceFile, BatchSourceFile, RangePosition}
-import scala.collection.mutable.ArrayBuffer
-import scala.reflect.internal.Chars.{isLineBreakChar, isWhitespace}
-import ast.parser.Tokens._
-
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-trait ScratchPadMaker { self: Global =>
-
- import definitions._
-
- private case class Patch(offset: Int, text: String)
-
- private class Patcher(contents: Array[Char], lex: LexicalStructure, endOffset: Int) extends Traverser {
- var objectName: String = ""
-
- private val patches = new ArrayBuffer[Patch]
- private val toPrint = new ArrayBuffer[String]
- private var skipped = 0
- private var resNum: Int = -1
-
- private def nextRes(): String = {
- resNum += 1
- "res$"+resNum
- }
-
- private def nameType(name: String, tpe: Type): String = {
- // if name ends in symbol character, add a space to separate it from the following ':'
- val pad = if (Character.isLetter(name.last) || Character.isDigit(name.last)) "" else " "
- name+pad+": "+tpe
- }
-
- private def nameType(sym: Symbol): String = nameType(sym.name.decoded, sym.tpe)
-
- private def literal(str: String) = "\"\"\""+str+"\"\"\""
-
- private val prologue = ";import scala.runtime.WorksheetSupport._; def main(args: Array[String])=$execute{"
-
- private val epilogue = "}"
-
- private def applyPendingPatches(offset: Int) = {
- if (skipped == 0) patches += Patch(offset, prologue)
- for (msg <- toPrint) patches += Patch(offset, ";System.out.println("+msg+")")
- toPrint.clear()
- }
-
- /** The position where to insert an instrumentation statement in front of given statement.
- * This is at the latest `stat.pos.start`. But in order not to mess with column numbers
- * in position we try to insert it at the end of the previous token instead.
- * Furthermore, `(' tokens have to be skipped because they do not show up
- * in statement range positions.
- */
- private def instrumentPos(start: Int): Int = {
- val (prevToken, prevStart, prevEnd) = lex.locate(start - 1)
- if (prevStart >= start) start
- else if (prevToken == LPAREN) instrumentPos(prevStart)
- else prevEnd
- }
-
- private def addSkip(stat: Tree): Unit = {
- val ipos = instrumentPos(stat.pos.start)
- if (stat.pos.start > skipped) applyPendingPatches(ipos)
- if (stat.pos.start >= endOffset)
- patches += Patch(ipos, ";$stop()")
- var end = stat.pos.end
- if (end > skipped) {
- while (end < contents.length && !isLineBreakChar(contents(end))) end += 1
- patches += Patch(ipos, ";$skip("+(end-skipped)+"); ")
- skipped = end
- }
- }
-
- private def addSandbox(expr: Tree) = {}
-// patches += (Patch(expr.pos.start, "sandbox("), Patch(expr.pos.end, ")"))
-
- private def resultString(prefix: String, expr: String) =
- literal(prefix + " = ") + " + $show(" + expr + ")"
-
- private def traverseStat(stat: Tree) =
- if (stat.pos.isInstanceOf[RangePosition]) {
- stat match {
- case ValDef(_, _, _, rhs) =>
- addSkip(stat)
- if (stat.symbol.isLazy)
- toPrint += literal(nameType(stat.symbol) + " = <lazy>")
- else if (!stat.symbol.isSynthetic) {
- addSandbox(rhs)
- toPrint += resultString(nameType(stat.symbol), stat.symbol.name.toString)
- }
- case DefDef(_, _, _, _, _, _) =>
- addSkip(stat)
- toPrint += literal(nameType(stat.symbol))
- case Annotated(_, arg) =>
- traverse(arg)
- case DocDef(_, defn) =>
- traverse(defn)
- case _ =>
- if (stat.isTerm) {
- addSkip(stat)
- if (stat.tpe.typeSymbol == UnitClass) {
- addSandbox(stat)
- } else {
- val resName = nextRes()
- val dispResName = resName filter ('$' != _)
- val offset = instrumentPos(stat.pos.start)
- patches += Patch(offset, "val " + resName + " = ")
- addSandbox(stat)
- toPrint += resultString(nameType(dispResName, stat.tpe), resName)
- }
- }
- }
- }
-
- override def traverse(tree: Tree): Unit = tree match {
- case PackageDef(_, _) =>
- super.traverse(tree)
- case ModuleDef(_, name, Template(_, _, body)) =>
- val topLevel = objectName.isEmpty
- if (topLevel) {
- objectName = tree.symbol.fullName
- body foreach traverseStat
- if (skipped != 0) { // don't issue prologue and epilogue if there are no instrumented statements
- applyPendingPatches(skipped)
- patches += Patch(skipped, epilogue)
- }
- }
- case _ =>
- }
-
- /** The patched text.
- * @require traverse is run first
- */
- def result: Array[Char] = {
- val reslen = contents.length + (patches map (_.text.length)).sum
- val res = Array.ofDim[Char](reslen)
- var lastOffset = 0
- var from = 0
- var to = 0
- for (Patch(offset, text) <- patches) {
- val delta = offset - lastOffset
- assert(delta >= 0)
- Array.copy(contents, from, res, to, delta)
- from += delta
- to += delta
- lastOffset = offset
- text.copyToArray(res, to)
- to += text.length
- }
- assert(contents.length - from == reslen - to)
- Array.copy(contents, from, res, to, contents.length - from)
- res
- }
- }
-
- class LexicalStructure(source: SourceFile) {
- val token = new ArrayBuffer[Int]
- val startOffset = new ArrayBuffer[Int]
- val endOffset = new ArrayBuffer[Int]
- private val scanner = new syntaxAnalyzer.UnitScanner(new CompilationUnit(source))
- scanner.init()
- while (scanner.token != EOF) {
- startOffset += scanner.offset
- token += scanner.token
- scanner.nextToken()
- endOffset += scanner.lastOffset
- }
-
- /** @return token that starts before or at offset, its startOffset, its endOffset
- */
- def locate(offset: Int): (Int, Int, Int) = {
- var lo = 0
- var hi = token.length - 1
- while (lo < hi) {
- val mid = (lo + hi + 1) / 2
- if (startOffset(mid) <= offset) lo = mid
- else hi = mid - 1
- }
- (token(lo), startOffset(lo), endOffset(lo))
- }
- }
-
- /** Compute an instrumented version of a sourcefile.
- * @param source The given sourcefile.
- * @param line The line up to which results should be printed, -1 = whole document.
- * @return A pair consisting of
- * - the fully qualified name of the first top-level object definition in the file.
- * or "" if there are no object definitions.
- * - the text of the instrumented program which, when run,
- * prints its output and all defined values in a comment column.
- */
- protected def instrument(source: SourceFile, line: Int): (String, Array[Char]) = {
- val tree = typedTree(source, forceReload = true)
- val endOffset = if (line < 0) source.length else source.lineToOffset(line + 1)
- val patcher = new Patcher(source.content, new LexicalStructure(source), endOffset)
- patcher.traverse(tree)
- (patcher.objectName, patcher.result)
- }
-}
diff --git a/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala b/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala
index 451cf70bc2..bc490d8d45 100644
--- a/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala
+++ b/src/interactive/scala/tools/nsc/interactive/tests/core/CoreTestDefs.scala
@@ -40,9 +40,6 @@ private[tests] trait CoreTestDefs
extends PresentationCompilerTestDef
with AskScopeCompletionAt {
- def memberPrinter(member: compiler.Member): String =
- "[accessible: %5s] ".format(member.accessible) + "`" + (member.sym.toString() + member.tpe.toString()).trim() + "`"
-
override def runTest() {
askAllSources(ScopeCompletionMarker) { pos =>
askScopeCompletionAt(pos)
diff --git a/src/library/scala/Predef.scala b/src/library/scala/Predef.scala
index cd96b5182c..8900450fa3 100644
--- a/src/library/scala/Predef.scala
+++ b/src/library/scala/Predef.scala
@@ -26,8 +26,6 @@ import scala.io.ReadStdin
* [[scala.collection.immutable.Set]], and the [[scala.collection.immutable.List]]
* constructors ([[scala.collection.immutable.::]] and
* [[scala.collection.immutable.Nil]]).
- * The types `Pair` (a [[scala.Tuple2]]) and `Triple` (a [[scala.Tuple3]]), with
- * simple constructors, are also provided.
*
* === Console I/O ===
* Predef provides a number of simple functions for console I/O, such as
@@ -230,13 +228,17 @@ object Predef extends LowPriorityImplicits with DeprecatedPredef {
// tupling ------------------------------------------------------------
+ @deprecated("Use built-in tuple syntax or Tuple2 instead", "2.11.0")
type Pair[+A, +B] = Tuple2[A, B]
+ @deprecated("Use built-in tuple syntax or Tuple2 instead", "2.11.0")
object Pair {
def apply[A, B](x: A, y: B) = Tuple2(x, y)
def unapply[A, B](x: Tuple2[A, B]): Option[Tuple2[A, B]] = Some(x)
}
+ @deprecated("Use built-in tuple syntax or Tuple3 instead", "2.11.0")
type Triple[+A, +B, +C] = Tuple3[A, B, C]
+ @deprecated("Use built-in tuple syntax or Tuple3 instead", "2.11.0")
object Triple {
def apply[A, B, C](x: A, y: B, z: C) = Tuple3(x, y, z)
def unapply[A, B, C](x: Tuple3[A, B, C]): Option[Tuple3[A, B, C]] = Some(x)
diff --git a/src/library/scala/Responder.scala b/src/library/scala/Responder.scala
index 0a42ddb0ea..8a658e252a 100644
--- a/src/library/scala/Responder.scala
+++ b/src/library/scala/Responder.scala
@@ -18,6 +18,7 @@ package scala
* @see class Responder
* @since 2.1
*/
+@deprecated("This object will be removed", "2.11.0")
object Responder {
/** Creates a responder that answer continuations with the constant `a`.
@@ -58,6 +59,7 @@ object Responder {
* @version 1.0
* @since 2.1
*/
+@deprecated("This class will be removed", "2.11.0")
abstract class Responder[+A] extends Serializable {
def respond(k: A => Unit): Unit
diff --git a/src/library/scala/annotation/migration.scala b/src/library/scala/annotation/migration.scala
index 65bee4c2cb..e71be00f32 100644
--- a/src/library/scala/annotation/migration.scala
+++ b/src/library/scala/annotation/migration.scala
@@ -25,7 +25,4 @@ package scala.annotation
*
* @since 2.8
*/
- private[scala] final class migration(message: String, changedIn: String) extends scala.annotation.StaticAnnotation {
- @deprecated("Use the constructor taking two Strings instead.", "2.10.0")
- def this(majorVersion: Int, minorVersion: Int, message: String) = this(message, majorVersion + "." + minorVersion)
- }
+ private[scala] final class migration(message: String, changedIn: String) extends scala.annotation.StaticAnnotation
diff --git a/src/library/scala/collection/immutable/Range.scala b/src/library/scala/collection/immutable/Range.scala
index 34b2346851..00f398a4b0 100644
--- a/src/library/scala/collection/immutable/Range.scala
+++ b/src/library/scala/collection/immutable/Range.scala
@@ -117,22 +117,6 @@ extends scala.collection.AbstractSeq[Int]
fail()
}
- @deprecated("Range.foreach() is now self-contained, making this auxiliary method redundant.", "2.10.1")
- def validateRangeBoundaries(f: Int => Any): Boolean = {
- validateMaxLength()
-
- start != Int.MinValue || end != Int.MinValue || {
- var count = 0
- var num = start
- while (count < numRangeElements) {
- f(num)
- count += 1
- num += step
- }
- false
- }
- }
-
final def apply(idx: Int): Int = {
validateMaxLength()
if (idx < 0 || idx >= numRangeElements) throw new IndexOutOfBoundsException(idx.toString)
diff --git a/src/library/scala/math/BigDecimal.scala b/src/library/scala/math/BigDecimal.scala
index 0a2da16523..d783dd29f5 100644
--- a/src/library/scala/math/BigDecimal.scala
+++ b/src/library/scala/math/BigDecimal.scala
@@ -158,8 +158,7 @@ object BigDecimal {
* @author Stephane Micheloud
* @version 1.0
*/
-@deprecatedInheritance("This class will be made final.", "2.10.0")
-class BigDecimal(
+final class BigDecimal(
val bigDecimal: BigDec,
val mc: MathContext)
extends ScalaNumber with ScalaNumericConversions with Serializable {
diff --git a/src/library/scala/math/BigInt.scala b/src/library/scala/math/BigInt.scala
index b25dbefebd..5e70bdc2f6 100644
--- a/src/library/scala/math/BigInt.scala
+++ b/src/library/scala/math/BigInt.scala
@@ -109,8 +109,7 @@ object BigInt {
* @author Martin Odersky
* @version 1.0, 15/07/2003
*/
-@deprecatedInheritance("This class will be made final.", "2.10.0")
-class BigInt(val bigInteger: BigInteger) extends ScalaNumber with ScalaNumericConversions with Serializable {
+final class BigInt(val bigInteger: BigInteger) extends ScalaNumber with ScalaNumericConversions with Serializable {
/** Returns the hash code for this BigInt. */
override def hashCode(): Int =
if (isValidLong) unifiedPrimitiveHashcode()
diff --git a/src/library/scala/reflect/ClassManifestDeprecatedApis.scala b/src/library/scala/reflect/ClassManifestDeprecatedApis.scala
index 798746851a..ca7a3cddb8 100644
--- a/src/library/scala/reflect/ClassManifestDeprecatedApis.scala
+++ b/src/library/scala/reflect/ClassManifestDeprecatedApis.scala
@@ -16,6 +16,7 @@ import java.lang.{ Class => jClass }
trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
self: ClassManifest[T] =>
+ // Still in use in target test.junit.comp.
@deprecated("Use runtimeClass instead", "2.10.0")
def erasure: jClass[_] = runtimeClass
@@ -64,12 +65,12 @@ trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
// when the erasure is the same, even before considering variance.
!cannotMatch && {
// this part is wrong for not considering variance
- if (this.erasure == that.erasure)
+ if (this.runtimeClass == that.runtimeClass)
subargs(this.typeArguments, that.typeArguments)
// this part is wrong for punting unless the rhs has no type
// arguments, but it's better than a blindfolded pinata swing.
else
- that.typeArguments.isEmpty && subtype(this.erasure, that.erasure)
+ that.typeArguments.isEmpty && subtype(this.runtimeClass, that.runtimeClass)
}
}
@@ -91,29 +92,29 @@ trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
@deprecated("Use wrap instead", "2.10.0")
def arrayManifest: ClassManifest[Array[T]] =
- ClassManifest.classType[Array[T]](arrayClass[T](erasure), this)
+ ClassManifest.classType[Array[T]](arrayClass[T](runtimeClass), this)
override def newArray(len: Int): Array[T] =
- java.lang.reflect.Array.newInstance(erasure, len).asInstanceOf[Array[T]]
+ java.lang.reflect.Array.newInstance(runtimeClass, len).asInstanceOf[Array[T]]
@deprecated("Use wrap.newArray instead", "2.10.0")
def newArray2(len: Int): Array[Array[T]] =
- java.lang.reflect.Array.newInstance(arrayClass[T](erasure), len)
+ java.lang.reflect.Array.newInstance(arrayClass[T](runtimeClass), len)
.asInstanceOf[Array[Array[T]]]
@deprecated("Use wrap.wrap.newArray instead", "2.10.0")
def newArray3(len: Int): Array[Array[Array[T]]] =
- java.lang.reflect.Array.newInstance(arrayClass[Array[T]](arrayClass[T](erasure)), len)
+ java.lang.reflect.Array.newInstance(arrayClass[Array[T]](arrayClass[T](runtimeClass)), len)
.asInstanceOf[Array[Array[Array[T]]]]
@deprecated("Use wrap.wrap.wrap.newArray instead", "2.10.0")
def newArray4(len: Int): Array[Array[Array[Array[T]]]] =
- java.lang.reflect.Array.newInstance(arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](erasure))), len)
+ java.lang.reflect.Array.newInstance(arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](runtimeClass))), len)
.asInstanceOf[Array[Array[Array[Array[T]]]]]
@deprecated("Use wrap.wrap.wrap.wrap.newArray instead", "2.10.0")
def newArray5(len: Int): Array[Array[Array[Array[Array[T]]]]] =
- java.lang.reflect.Array.newInstance(arrayClass[Array[Array[Array[T]]]](arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](erasure)))), len)
+ java.lang.reflect.Array.newInstance(arrayClass[Array[Array[Array[T]]]](arrayClass[Array[Array[T]]](arrayClass[Array[T]](arrayClass[T](runtimeClass)))), len)
.asInstanceOf[Array[Array[Array[Array[Array[T]]]]]]
@deprecated("Create WrappedArray directly instead", "2.10.0")
@@ -131,7 +132,7 @@ trait ClassManifestDeprecatedApis[T] extends OptManifest[T] {
protected def argString =
if (typeArguments.nonEmpty) typeArguments.mkString("[", ", ", "]")
- else if (erasure.isArray) "["+ClassManifest.fromClass(erasure.getComponentType)+"]"
+ else if (runtimeClass.isArray) "["+ClassManifest.fromClass(runtimeClass.getComponentType)+"]"
else ""
}
@@ -221,7 +222,7 @@ object ClassManifestFactory {
*/
def abstractType[T](prefix: OptManifest[_], name: String, upperbound: ClassManifest[_], args: OptManifest[_]*): ClassManifest[T] =
new ClassManifest[T] {
- override def runtimeClass = upperbound.erasure
+ override def runtimeClass = upperbound.runtimeClass
override val typeArguments = args.toList
override def toString = prefix.toString+"#"+name+argString
}
@@ -236,6 +237,6 @@ private class ClassTypeManifest[T](
{
override def toString =
(if (prefix.isEmpty) "" else prefix.get.toString+"#") +
- (if (erasure.isArray) "Array" else erasure.getName) +
+ (if (runtimeClass.isArray) "Array" else runtimeClass.getName) +
argString
} \ No newline at end of file
diff --git a/src/library/scala/reflect/Manifest.scala b/src/library/scala/reflect/Manifest.scala
index 3bc76da295..803c980058 100644
--- a/src/library/scala/reflect/Manifest.scala
+++ b/src/library/scala/reflect/Manifest.scala
@@ -46,7 +46,7 @@ trait Manifest[T] extends ClassManifest[T] with Equals {
override def typeArguments: List[Manifest[_]] = Nil
override def arrayManifest: Manifest[Array[T]] =
- Manifest.classType[Array[T]](arrayClass[T](erasure), this)
+ Manifest.classType[Array[T]](arrayClass[T](runtimeClass), this)
override def canEqual(that: Any): Boolean = that match {
case _: Manifest[_] => true
@@ -56,10 +56,10 @@ trait Manifest[T] extends ClassManifest[T] with Equals {
* faster than <:< and rules out most comparisons.
*/
override def equals(that: Any): Boolean = that match {
- case m: Manifest[_] => (m canEqual this) && (this.erasure == m.erasure) && (this <:< m) && (m <:< this)
+ case m: Manifest[_] => (m canEqual this) && (this.runtimeClass == m.runtimeClass) && (this <:< m) && (m <:< this)
case _ => false
}
- override def hashCode = this.erasure.##
+ override def hashCode = this.runtimeClass.##
}
// TODO undeprecated until Scala reflection becomes non-experimental
@@ -238,7 +238,7 @@ object ManifestFactory {
override val typeArguments: List[Manifest[_]]) extends Manifest[T] {
override def toString =
(if (prefix.isEmpty) "" else prefix.get.toString+"#") +
- (if (erasure.isArray) "Array" else erasure.getName) +
+ (if (runtimeClass.isArray) "Array" else runtimeClass.getName) +
argString
}
@@ -259,7 +259,7 @@ object ManifestFactory {
*/
def wildcardType[T](lowerBound: Manifest[_], upperBound: Manifest[_]): Manifest[T] =
new Manifest[T] {
- def runtimeClass = upperBound.erasure
+ def runtimeClass = upperBound.runtimeClass
override def toString =
"_" +
(if (lowerBound eq Nothing) "" else " >: "+lowerBound) +
@@ -269,7 +269,7 @@ object ManifestFactory {
/** Manifest for the intersection type `parents_0 with ... with parents_n'. */
def intersectionType[T](parents: Manifest[_]*): Manifest[T] =
new Manifest[T] {
- def runtimeClass = parents.head.erasure
+ def runtimeClass = parents.head.runtimeClass
override def toString = parents.mkString(" with ")
}
}
diff --git a/src/library/scala/runtime/WorksheetSupport.scala b/src/library/scala/runtime/WorksheetSupport.scala
deleted file mode 100644
index d86f8873aa..0000000000
--- a/src/library/scala/runtime/WorksheetSupport.scala
+++ /dev/null
@@ -1,93 +0,0 @@
-package scala.runtime
-import java.io.{OutputStream, PrintStream}
-import scala.runtime.ScalaRunTime.stringOf
-
-/** A utility object that's needed by the code that executes a worksheet.
- */
-@deprecated("SI-6458: Instrumentation logic will be moved out of the compiler.","2.10.0")
-object WorksheetSupport {
-
- /** The offset in the source which should be printed */
- private var currentOffset = 0
-
- /** A stream that flushes in regular intervals so that output can be captured
- * in real time. The flush interval is determined by the field "flushInterval".
- * By default it is 30ms.
- */
- private class FlushedOutputStream(out: OutputStream) extends OutputStream {
- protected def flushInterval = 30000000L // interval between flushes, by default 30ms
- protected def width = 80 // output width, by default 80 characters
- protected def tabInc = 8 // tab increment, by default 8 characters
- private var lastFlush: Long = 0L
- private var col = -1
- override def write(b: Array[Byte], off: Int, len: Int) = {
- for (idx <- off until (off + len min b.length)) writeOne(b(idx).toInt)
- flush()
- }
- override def write(c: Int) {
- writeOne(c)
- flush()
- }
- override def flush() {
- val current = System.nanoTime
- if (current - lastFlush >= flushInterval) {
- out.flush()
- lastFlush = current
- }
- }
- def writeOne(c: Int) {
- if (col < 0) {
- col = 0
- write((currentOffset+" ").getBytes)
- }
- out.write(c)
- col =
- if (c == '\n') -1
- else if (c == '\t') (col / tabInc) * tabInc + tabInc
- else col + 1
- if (col >= width) writeOne('\n')
- }
- def ensureNewLine() = if (col > 0) writeOne('\n')
- }
-
- private val flushedOut = new FlushedOutputStream(System.out)
- private val printOut = new PrintStream(flushedOut)
-
- private def redirected(op: => Unit) = {
- val oldSysOut = System.out
- val oldSysErr = System.err
- val oldConsOut = Console.out
- val oldConsErr = Console.err
- System.setOut(printOut)
- System.setErr(printOut)
- Console.setOut(printOut)
- Console.setErr(printOut)
- try op
- finally {
- printOut.close()
- System.setOut(oldSysOut)
- System.setErr(oldSysErr)
- Console.setOut(oldConsOut)
- Console.setErr(oldConsErr)
- }
- }
-
- def $execute(op: => Unit) = redirected {
- try op
- catch {
- case ex: StopException => ;
- case ex: Throwable => ex.printStackTrace()
- }
- }
-
- def $skip(n: Int) = {
- flushedOut.ensureNewLine()
- currentOffset += n
- }
-
- def $stop() = throw new StopException
-
- def $show(x: Any): String = stringOf(x)
-}
-
-class StopException extends Exception
diff --git a/src/library/scala/util/hashing/MurmurHash3.scala b/src/library/scala/util/hashing/MurmurHash3.scala
index c85664349e..1bfaeb255b 100644
--- a/src/library/scala/util/hashing/MurmurHash3.scala
+++ b/src/library/scala/util/hashing/MurmurHash3.scala
@@ -275,12 +275,4 @@ object MurmurHash3 extends MurmurHash3 {
finalizeHash(h, n)
}
*/
-
- @deprecated("Use unorderedHash", "2.10.0")
- final def symmetricHash[T](xs: scala.collection.GenTraversableOnce[T], seed: Int = symmetricSeed): Int =
- unorderedHash(xs.seq, seed)
-
- @deprecated("Use orderedHash", "2.10.0")
- final def traversableHash[T](xs: scala.collection.GenTraversableOnce[T], seed: Int = traversableSeed): Int =
- orderedHash(xs.seq, seed)
}
diff --git a/src/reflect/scala/reflect/api/JavaUniverse.scala b/src/reflect/scala/reflect/api/JavaUniverse.scala
index 6fc76c9693..df5e0699a5 100644
--- a/src/reflect/scala/reflect/api/JavaUniverse.scala
+++ b/src/reflect/scala/reflect/api/JavaUniverse.scala
@@ -34,7 +34,7 @@ trait JavaUniverse extends Universe with JavaMirrors { self =>
mirror.universe match {
case ju: JavaUniverse =>
val jm = mirror.asInstanceOf[ju.Mirror]
- val sym = jm.classSymbol(manifest.erasure)
+ val sym = jm.classSymbol(manifest.runtimeClass)
val tpe =
if (manifest.typeArguments.isEmpty) sym.toType
else ju.appliedType(sym.toTypeConstructor, manifest.typeArguments map (targ => ju.manifestToTypeTag(jm, targ)) map (_.in(jm).tpe))
diff --git a/src/reflect/scala/reflect/internal/Definitions.scala b/src/reflect/scala/reflect/internal/Definitions.scala
index 563f23cb3b..19f06894c8 100644
--- a/src/reflect/scala/reflect/internal/Definitions.scala
+++ b/src/reflect/scala/reflect/internal/Definitions.scala
@@ -16,7 +16,7 @@ import scala.reflect.api.{Universe => ApiUniverse}
trait Definitions extends api.StandardDefinitions {
self: SymbolTable =>
- import rootMirror.{getModule, getPackage, getClassByName, getRequiredClass, getRequiredModule, getClassIfDefined, getModuleIfDefined, getPackageObject, getPackageIfDefined, getPackageObjectIfDefined, requiredClass, requiredModule}
+ import rootMirror.{getModuleByName, getPackage, getClassByName, getRequiredClass, getRequiredModule, getClassIfDefined, getModuleIfDefined, getPackageObject, getPackageIfDefined, getPackageObjectIfDefined, requiredClass, requiredModule}
object definitions extends DefinitionsClass
@@ -87,7 +87,7 @@ trait Definitions extends api.StandardDefinitions {
lazy val abbrvTag = symbolsMap(ScalaValueClasses, nameToTag) withDefaultValue OBJECT_TAG
lazy val numericWeight = symbolsMapFilt(ScalaValueClasses, nameToWeight.keySet, nameToWeight)
- lazy val boxedModule = classesMap(x => getModule(boxedName(x)))
+ lazy val boxedModule = classesMap(x => getModuleByName(boxedName(x)))
lazy val boxedClass = classesMap(x => getClassByName(boxedName(x)))
lazy val refClass = classesMap(x => getRequiredClass("scala.runtime." + x + "Ref"))
lazy val volatileRefClass = classesMap(x => getRequiredClass("scala.runtime.Volatile" + x + "Ref"))
@@ -153,18 +153,6 @@ trait Definitions extends api.StandardDefinitions {
private var isInitialized = false
def isDefinitionsInitialized = isInitialized
- @deprecated("Moved to rootMirror.RootPackage", "2.10.0")
- val RootPackage: ModuleSymbol = rootMirror.RootPackage
-
- @deprecated("Moved to rootMirror.RootClass", "2.10.0")
- val RootClass: ClassSymbol = rootMirror.RootClass
-
- @deprecated("Moved to rootMirror.EmptyPackage", "2.10.0")
- val EmptyPackage: ModuleSymbol = rootMirror.EmptyPackage
-
- @deprecated("Moved to rootMirror.EmptyPackageClass", "2.10.0")
- val EmptyPackageClass: ClassSymbol = rootMirror.EmptyPackageClass
-
// It becomes tricky to create dedicated objects for other symbols because
// of initialization order issues.
lazy val JavaLangPackage = getPackage("java.lang")
diff --git a/src/reflect/scala/reflect/internal/FreshNames.scala b/src/reflect/scala/reflect/internal/FreshNames.scala
new file mode 100644
index 0000000000..bb488aa2a8
--- /dev/null
+++ b/src/reflect/scala/reflect/internal/FreshNames.scala
@@ -0,0 +1,35 @@
+/* NSC -- new Scala compiler
+ * Copyright 2005-2013 LAMP/EPFL
+ */
+
+package scala
+package reflect
+package internal
+
+import scala.reflect.internal.util.FreshNameCreator
+
+trait FreshNames { self: Names =>
+ // default fresh name creator used to abstract over currentUnit.fresh and runtime fresh name creator
+ def currentFreshNameCreator: FreshNameCreator
+
+ // create fresh term/type name using implicit fresh name creator
+ def freshTermName(prefix: String = "x$")(implicit creator: FreshNameCreator): TermName = newTermName(creator.newName(prefix))
+ def freshTypeName(prefix: String)(implicit creator: FreshNameCreator): TypeName = newTypeName(creator.newName(prefix))
+
+ // Extractor that matches names which were generated by some
+ // FreshNameCreator with known prefix. Extracts user-specified
+ // prefix that was used as a parameter to newName by stripping
+ // global creator prefix and unique number in the end of the name.
+ class FreshNameExtractor(creatorPrefix: String = "") {
+ // quote prefix so that it can be used with replaceFirst
+ // which expects regExp rather than simple string
+ val quotedCreatorPrefix = java.util.regex.Pattern.quote(creatorPrefix)
+
+ def unapply(name: Name): Option[String] = {
+ val sname = name.toString
+ // name should start with creatorPrefix and end with number
+ if (!sname.startsWith(creatorPrefix) || !sname.matches("^.*\\d*$")) None
+ else Some(NameTransformer.decode(sname.replaceFirst(quotedCreatorPrefix, "").replaceAll("\\d*$", "")))
+ }
+ }
+} \ No newline at end of file
diff --git a/src/reflect/scala/reflect/internal/Mirrors.scala b/src/reflect/scala/reflect/internal/Mirrors.scala
index e122fa498b..3a630b6a16 100644
--- a/src/reflect/scala/reflect/internal/Mirrors.scala
+++ b/src/reflect/scala/reflect/internal/Mirrors.scala
@@ -96,10 +96,6 @@ trait Mirrors extends api.Mirrors {
}
}
- @deprecated("Use getClassByName", "2.10.0")
- def getClass(fullname: Name): ClassSymbol =
- getClassByName(fullname)
-
def getClassByName(fullname: Name): ClassSymbol =
ensureClassSymbol(fullname.toString, getModuleOrClass(fullname.toTypeName))
@@ -131,15 +127,11 @@ trait Mirrors extends api.Mirrors {
case _ => MissingRequirementError.notFound("object " + fullname)
}
- @deprecated("Use getModuleByName", "2.10.0")
- def getModule(fullname: Name): ModuleSymbol =
- getModuleByName(fullname)
-
def getModuleByName(fullname: Name): ModuleSymbol =
ensureModuleSymbol(fullname.toString, getModuleOrClass(fullname.toTermName), allowPackages = true)
def getRequiredModule(fullname: String): ModuleSymbol =
- getModule(newTermNameCached(fullname))
+ getModuleByName(newTermNameCached(fullname))
// TODO: What syntax do we think should work here? Say you have an object
// like scala.Predef. You can't say requiredModule[scala.Predef] since there's
@@ -155,7 +147,7 @@ trait Mirrors extends api.Mirrors {
getModuleIfDefined(newTermNameCached(fullname))
def getModuleIfDefined(fullname: Name): Symbol =
- wrapMissing(getModule(fullname.toTermName))
+ wrapMissing(getModuleByName(fullname.toTermName))
/** @inheritdoc
*
diff --git a/src/reflect/scala/reflect/internal/SymbolTable.scala b/src/reflect/scala/reflect/internal/SymbolTable.scala
index 4998580a7d..c3f3e35fb3 100644
--- a/src/reflect/scala/reflect/internal/SymbolTable.scala
+++ b/src/reflect/scala/reflect/internal/SymbolTable.scala
@@ -42,6 +42,7 @@ abstract class SymbolTable extends macros.Universe
with BuildUtils
with PrivateWithin
with pickling.Translations
+ with FreshNames
{
val gen = new TreeGen { val global: SymbolTable.this.type = SymbolTable.this }
@@ -398,11 +399,6 @@ abstract class SymbolTable extends macros.Universe
* Adds the `sm` String interpolator to a [[scala.StringContext]].
*/
implicit val StringContextStripMarginOps: StringContext => StringContextStripMarginOps = util.StringContextStripMarginOps
-
- // fresh name creation
- def currentFreshNameCreator: FreshNameCreator
- def freshTermName(prefix: String = "x$")(implicit creator: FreshNameCreator): TermName = newTermName(creator.newName(prefix))
- def freshTypeName(prefix: String)(implicit creator: FreshNameCreator): TypeName = newTypeName(creator.newName(prefix))
}
object SymbolTableStats {
diff --git a/src/reflect/scala/reflect/internal/Symbols.scala b/src/reflect/scala/reflect/internal/Symbols.scala
index bd17c18119..85bc3158f6 100644
--- a/src/reflect/scala/reflect/internal/Symbols.scala
+++ b/src/reflect/scala/reflect/internal/Symbols.scala
@@ -452,23 +452,6 @@ trait Symbols extends api.Symbols { self: SymbolTable =>
case _ => new StubTermSymbol(this, name.toTermName, missingMessage)
}
- @deprecated("Use the other signature", "2.10.0")
- def newClass(pos: Position, name: TypeName): Symbol = newClass(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newModuleClass(pos: Position, name: TypeName): Symbol = newModuleClass(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newLabel(pos: Position, name: TermName): MethodSymbol = newLabel(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newValue(pos: Position, name: TermName): TermSymbol = newTermSymbol(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newAliasType(pos: Position, name: TypeName): Symbol = newAliasType(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newAbstractType(pos: Position, name: TypeName): Symbol = newAbstractType(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newExistential(pos: Position, name: TypeName): Symbol = newExistential(name, pos)
- @deprecated("Use the other signature", "2.10.0")
- def newMethod(pos: Position, name: TermName): MethodSymbol = newMethod(name, pos)
-
// ----- locking and unlocking ------------------------------------------------------
// True if the symbol is unlocked.
@@ -2047,10 +2030,6 @@ trait Symbols extends api.Symbols { self: SymbolTable =>
else if (isMethod || isClass) this
else owner.logicallyEnclosingMember
- /** Kept for source compatibility with 2.9. Scala IDE for Eclipse relies on this. */
- @deprecated("Use enclosingTopLevelClass", "2.10.0")
- def toplevelClass: Symbol = enclosingTopLevelClass
-
/** The top-level class containing this symbol. */
def enclosingTopLevelClass: Symbol =
if (isTopLevel) {
@@ -2365,9 +2344,6 @@ trait Symbols extends api.Symbols { self: SymbolTable =>
def associatedFile: AbstractFile = enclosingTopLevelClass.associatedFile
def associatedFile_=(f: AbstractFile) { abort("associatedFile_= inapplicable for " + this) }
- @deprecated("Use associatedFile_= instead", "2.10.0")
- def sourceFile_=(f: AbstractFile): Unit = associatedFile_=(f)
-
/** If this is a sealed class, its known direct subclasses.
* Otherwise, the empty set.
*/
diff --git a/src/reflect/scala/reflect/internal/TreeInfo.scala b/src/reflect/scala/reflect/internal/TreeInfo.scala
index 8982fd4246..a933a5d189 100644
--- a/src/reflect/scala/reflect/internal/TreeInfo.scala
+++ b/src/reflect/scala/reflect/internal/TreeInfo.scala
@@ -848,7 +848,7 @@ abstract class TreeInfo {
})
def isMacroApplication(tree: Tree): Boolean =
- !tree.isDef && tree.symbol != null && tree.symbol.isMacro && !tree.symbol.isErroneous
+ !tree.isDef && tree.symbol != null && tree.symbol.isTermMacro && !tree.symbol.isErroneous
def isMacroApplicationOrBlock(tree: Tree): Boolean = tree match {
case Block(_, expr) => isMacroApplicationOrBlock(expr)
diff --git a/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala b/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala
index 3e54de8e1e..8442c1015f 100644
--- a/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala
+++ b/src/reflect/scala/reflect/internal/util/FreshNameCreator.scala
@@ -11,7 +11,7 @@ import java.util.concurrent.atomic.AtomicLong
import scala.collection.mutable
import scala.reflect.NameTransformer
-class FreshNameCreator {
+class FreshNameCreator(creatorPrefix: String = "") {
protected val counters = new ConcurrentHashMap[String, AtomicLong]()
/**
@@ -21,7 +21,8 @@ class FreshNameCreator {
*/
def newName(prefix: String): String = {
val safePrefix = NameTransformer.encode(prefix)
- counters.putIfAbsent(safePrefix, new AtomicLong(0));
- safePrefix + counters.get(safePrefix).incrementAndGet();
+ counters.putIfAbsent(safePrefix, new AtomicLong(0))
+ val idx = counters.get(safePrefix).incrementAndGet()
+ s"$creatorPrefix$safePrefix$idx"
}
}
diff --git a/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala b/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala
index bce506ee0a..344f7682c1 100644
--- a/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala
+++ b/src/reflect/scala/reflect/runtime/JavaUniverseForce.scala
@@ -51,6 +51,7 @@ trait JavaUniverseForce { self: runtime.JavaUniverse =>
// inaccessible: this.SimpleNameOrdering
this.traceSymbols
this.perRunCaches
+ this.FreshNameExtractor
this.FixedMirrorTreeCreator
this.FixedMirrorTypeCreator
this.CompoundTypeTreeOriginalAttachment
diff --git a/src/repl/scala/tools/nsc/interpreter/IMain.scala b/src/repl/scala/tools/nsc/interpreter/IMain.scala
index 0d55423247..8fba1e538e 100644
--- a/src/repl/scala/tools/nsc/interpreter/IMain.scala
+++ b/src/repl/scala/tools/nsc/interpreter/IMain.scala
@@ -9,10 +9,11 @@ package interpreter
import PartialFunction.cond
import scala.language.implicitConversions
+import scala.beans.BeanProperty
import scala.collection.mutable
import scala.concurrent.{ Future, ExecutionContext }
import scala.reflect.runtime.{ universe => ru }
-import scala.reflect.{ BeanProperty, ClassTag, classTag }
+import scala.reflect.{ ClassTag, classTag }
import scala.reflect.internal.util.{ BatchSourceFile, SourceFile }
import scala.tools.util.PathResolver
import scala.tools.nsc.io.AbstractFile
diff --git a/src/repl/scala/tools/nsc/interpreter/JavapClass.scala b/src/repl/scala/tools/nsc/interpreter/JavapClass.scala
index 50c90968af..496d5face1 100644
--- a/src/repl/scala/tools/nsc/interpreter/JavapClass.scala
+++ b/src/repl/scala/tools/nsc/interpreter/JavapClass.scala
@@ -180,7 +180,7 @@ class JavapClass(
/** Base class for javap tool adapters for java 6 and 7. */
abstract class JavapTool {
type ByteAry = Array[Byte]
- type Input = Pair[String, Try[ByteAry]]
+ type Input = Tuple2[String, Try[ByteAry]]
/** Run the tool. */
def apply(raw: Boolean, options: Seq[String])(inputs: Seq[Input]): List[JpResult]
diff --git a/src/scaladoc/scala/tools/ant/Scaladoc.scala b/src/scaladoc/scala/tools/ant/Scaladoc.scala
index fd6d637212..36a1405b11 100644
--- a/src/scaladoc/scala/tools/ant/Scaladoc.scala
+++ b/src/scaladoc/scala/tools/ant/Scaladoc.scala
@@ -574,7 +574,7 @@ class Scaladoc extends ScalaMatchingTask {
\*============================================================================*/
/** Initializes settings and source files */
- protected def initialize: Pair[Settings, List[File]] = {
+ protected def initialize: Tuple2[Settings, List[File]] = {
// Tests if all mandatory attributes are set and valid.
if (origin.isEmpty) buildError("Attribute 'srcdir' is not set.")
if (getOrigin.isEmpty) buildError("Attribute 'srcdir' is not set.")
@@ -660,14 +660,14 @@ class Scaladoc extends ScalaMatchingTask {
log("Scaladoc params = '" + addParams + "'", Project.MSG_DEBUG)
docSettings processArgumentString addParams
- Pair(docSettings, sourceFiles)
+ (docSettings, sourceFiles)
}
def safeBuildError(message: String): Unit = if (nofail) log(message) else buildError(message)
/** Performs the compilation. */
override def execute() = {
- val Pair(docSettings, sourceFiles) = initialize
+ val (docSettings, sourceFiles) = initialize
val reporter = new ConsoleReporter(docSettings)
try {
val docProcessor = new scala.tools.nsc.doc.DocFactory(reporter, docSettings)
diff --git a/src/scalap/scala/tools/scalap/Arguments.scala b/src/scalap/scala/tools/scalap/Arguments.scala
index 41346d13c0..cb0a92b6b3 100644
--- a/src/scalap/scala/tools/scalap/Arguments.scala
+++ b/src/scalap/scala/tools/scalap/Arguments.scala
@@ -46,8 +46,8 @@ object Arguments {
}
def parseBinding(str: String, separator: Char): (String, String) = (str indexOf separator) match {
- case -1 => argumentError("missing '" + separator + "' in binding '" + str + "'") ; Pair("", "")
- case idx => Pair((str take idx).trim, (str drop (idx + 1)).trim)
+ case -1 => argumentError("missing '" + separator + "' in binding '" + str + "'") ; ("", "")
+ case idx => ((str take idx).trim, (str drop (idx + 1)).trim)
}
def parse(args: Array[String]): Arguments = {
@@ -141,7 +141,7 @@ class Arguments {
if (key.length > 0)
bindings.getOrElseUpdate(tag, new mutable.HashMap)(key) = value
- def addBinding(tag: String, binding: Pair[String, String]): Unit =
+ def addBinding(tag: String, binding: Tuple2[String, String]): Unit =
addBinding(tag, binding._1, binding._2)
def addOther(arg: String): Unit = others += arg
diff --git a/test/disabled/run/lisp.scala b/test/disabled/run/lisp.scala
index 06e68f508a..73f24da757 100644
--- a/test/disabled/run/lisp.scala
+++ b/test/disabled/run/lisp.scala
@@ -12,11 +12,11 @@ class LispTokenizer(s: String) extends Iterator[String] {
while (i < s.length() && s.charAt(i) <= ' ') i += 1
i < s.length()
}
- def next: String =
+ def next: String =
if (hasNext) {
val start = i
if (isDelimiter(s charAt i)) i += 1
- else
+ else
do i = i + 1
while (!isDelimiter(s charAt i))
s.substring(start, i)
@@ -190,10 +190,10 @@ object LispCaseClasses extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
@@ -381,10 +381,10 @@ object LispAny extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
diff --git a/test/files/jvm/typerep.scala b/test/files/jvm/typerep.scala
index 1d6f0b7907..4f900d98d7 100644
--- a/test/files/jvm/typerep.scala
+++ b/test/files/jvm/typerep.scala
@@ -86,7 +86,7 @@ object testArrays {
object testTuples {
println(getType((3, "abc")))
- println(getType(Triple('a', 'b', "c")))
+ println(getType(('a', 'b', "c")))
println(getType(((3, "abc"), (4, "xyz"))))
println(getType(((Some('b'), 3), (Some('a'), 4))))
//println(getType(((Some('b'), 3), (None, 4))))
diff --git a/test/files/neg/class-of-double-targs.check b/test/files/neg/class-of-double-targs.check
new file mode 100644
index 0000000000..f7e2094f97
--- /dev/null
+++ b/test/files/neg/class-of-double-targs.check
@@ -0,0 +1,4 @@
+class-of-double-targs.scala:2: error: expression of type Class[Int](classOf[scala.Int]) does not take type parameters.
+ classOf[Int][Int]
+ ^
+one error found
diff --git a/test/files/neg/class-of-double-targs.scala b/test/files/neg/class-of-double-targs.scala
new file mode 100644
index 0000000000..26a2fa8381
--- /dev/null
+++ b/test/files/neg/class-of-double-targs.scala
@@ -0,0 +1,3 @@
+object Test {
+ classOf[Int][Int]
+}
diff --git a/test/files/neg/patmatexhaust.scala b/test/files/neg/patmatexhaust.scala
index aa7dac7d7d..f937197829 100644
--- a/test/files/neg/patmatexhaust.scala
+++ b/test/files/neg/patmatexhaust.scala
@@ -22,9 +22,9 @@ class TestSealedExhaustive { // compile only
def ma3(x:Mult) = (x,x) match { // not exhaustive
case (Kult(_), Qult()) => // Kult missing
- //case Pair(Kult(_), Kult(_)) =>
+ //case (Kult(_), Kult(_)) =>
case (Qult(), Kult(_)) => // Qult missing
- //case Pair(Qult(), Qult()) =>
+ //case (Qult(), Qult()) =>
}
def ma3u(x:Mult) = ((x,x) : @unchecked) match { // not exhaustive, but not checked!
diff --git a/test/files/neg/t414.scala b/test/files/neg/t414.scala
index 1662b9a105..86646d13c2 100644
--- a/test/files/neg/t414.scala
+++ b/test/files/neg/t414.scala
@@ -1,5 +1,5 @@
case class Empty[a]() extends IntMap[a];
-case class Node[a](left: IntMap[a], keyVal: Pair[Int, a], right: IntMap[a]) extends IntMap[a];
+case class Node[a](left: IntMap[a], keyVal: Tuple2[Int, a], right: IntMap[a]) extends IntMap[a];
abstract class IntMap[a] {
def lookup(key: Int): a = this match {
case Empty =>
diff --git a/test/files/neg/t5702-neg-bad-and-wild.check b/test/files/neg/t5702-neg-bad-and-wild.check
index ff9e5e5703..a52136dbf8 100644
--- a/test/files/neg/t5702-neg-bad-and-wild.check
+++ b/test/files/neg/t5702-neg-bad-and-wild.check
@@ -23,6 +23,6 @@ t5702-neg-bad-and-wild.scala:23: error: bad simple pattern: bad use of _* (a seq
val K(ns @ _*, x) = k // bad use of _* (a sequence pattern must be the last pattern)
^
t5702-neg-bad-and-wild.scala:24: error: bad simple pattern: bad use of _* (sequence pattern not allowed)
- val (b, _ * ) = Pair(5,6) // bad use of _* (sequence pattern not allowed)
+ val (b, _ * ) = (5,6) // bad use of _* (sequence pattern not allowed)
^
9 errors found
diff --git a/test/files/neg/t5702-neg-bad-and-wild.scala b/test/files/neg/t5702-neg-bad-and-wild.scala
index 3833a002b1..aadda37da7 100644
--- a/test/files/neg/t5702-neg-bad-and-wild.scala
+++ b/test/files/neg/t5702-neg-bad-and-wild.scala
@@ -21,7 +21,7 @@ object Test {
//gowild.scala:14: error: star patterns must correspond with varargs parameters
val K(is @ _*) = k
val K(ns @ _*, x) = k // bad use of _* (a sequence pattern must be the last pattern)
- val (b, _ * ) = Pair(5,6) // bad use of _* (sequence pattern not allowed)
+ val (b, _ * ) = (5,6) // bad use of _* (sequence pattern not allowed)
// no longer complains
//bad-and-wild.scala:15: error: ')' expected but '}' found.
}
diff --git a/test/files/neg/t997.scala b/test/files/neg/t997.scala
index e8d10f4317..1198738f24 100644
--- a/test/files/neg/t997.scala
+++ b/test/files/neg/t997.scala
@@ -1,5 +1,5 @@
// An extractor with 2 results
-object Foo { def unapply(x : String) = Some(Pair(x, x)) }
+object Foo { def unapply(x : String) = Some((x, x)) }
object Test extends App {
diff --git a/test/files/neg/wellkinded_wrongarity.check b/test/files/neg/wellkinded_wrongarity.check
index 1dc38db5c1..b9f033b453 100644
--- a/test/files/neg/wellkinded_wrongarity.check
+++ b/test/files/neg/wellkinded_wrongarity.check
@@ -1,4 +1,4 @@
-wellkinded_wrongarity.scala:5: error: Pair takes two type parameters, expected: one
-object mp extends Monad[Pair]
+wellkinded_wrongarity.scala:5: error: Tuple2 takes two type parameters, expected: one
+object mp extends Monad[Tuple2]
^
one error found
diff --git a/test/files/neg/wellkinded_wrongarity.scala b/test/files/neg/wellkinded_wrongarity.scala
index 2bb0e2ce8a..39c7601d53 100644
--- a/test/files/neg/wellkinded_wrongarity.scala
+++ b/test/files/neg/wellkinded_wrongarity.scala
@@ -2,4 +2,4 @@
class Monad[m[x]]
-object mp extends Monad[Pair]
+object mp extends Monad[Tuple2]
diff --git a/test/files/pos/bounds.scala b/test/files/pos/bounds.scala
index cfea4626c3..26bc84a1b9 100644
--- a/test/files/pos/bounds.scala
+++ b/test/files/pos/bounds.scala
@@ -1,11 +1,11 @@
trait Map[A, +C] {
- def ++ [B1 >: C] (kvs: Iterable[Pair[A, B1]]): Map[A, B1] = this
- def ++ [B1 >: C] (kvs: Iterator[Pair[A, B1]]): Map[A, B1] = this
+ def ++ [B1 >: C] (kvs: Iterable[Tuple2[A, B1]]): Map[A, B1] = this
+ def ++ [B1 >: C] (kvs: Iterator[Tuple2[A, B1]]): Map[A, B1] = this
}
class ListMap[A, +B] extends Map[A, B] {}
object ListMap {
def empty[X, Y] = new ListMap[X, Y]
- def apply[A1, B2](elems: Pair[A1, B2]*): Map[A1, B2] = empty[A1,B2].++(elems.iterator)
+ def apply[A1, B2](elems: Tuple2[A1, B2]*): Map[A1, B2] = empty[A1,B2].++(elems.iterator)
}
diff --git a/test/files/pos/patmat.scala b/test/files/pos/patmat.scala
index 4e652b146e..51b879abf2 100644
--- a/test/files/pos/patmat.scala
+++ b/test/files/pos/patmat.scala
@@ -3,8 +3,8 @@
object ZipFun {
//just compilation
- def zipFun[a, b](xs: List[a], ys: List[b]): List[Pair[a, b]] = (Pair(xs, ys): @unchecked) match {
- // !!! case Pair(List(), _), Pair(_, List()) => List()
+ def zipFun[a, b](xs: List[a], ys: List[b]): List[Tuple2[a, b]] = ((xs, ys): @unchecked) match {
+ // !!! case (List(), _), (_, List()) => List()
case (x :: xs1, y :: ys1) => (x, y) :: zipFun(xs1, ys1)
}
}
diff --git a/test/files/pos/spec-doubledef-new.scala b/test/files/pos/spec-doubledef-new.scala
index ad9c6399a5..589ceb33b2 100644
--- a/test/files/pos/spec-doubledef-new.scala
+++ b/test/files/pos/spec-doubledef-new.scala
@@ -19,12 +19,12 @@ abstract class B[T, @specialized(scala.Int) U : TypeTag, @specialized(scala.Int)
val u: U
val v: V
- def f(t: T, v2: V): Pair[U, V] = {
+ def f(t: T, v2: V): Tuple2[U, V] = {
val m: Array[U] = null
if (m.isEmpty) {
- Pair(u, v)
+ (u, v)
} else {
- Pair(u, v2)
+ (u, v2)
}
}
} \ No newline at end of file
diff --git a/test/files/pos/spec-doubledef-old.scala b/test/files/pos/spec-doubledef-old.scala
index 86b0d857d3..bde259e4fa 100644
--- a/test/files/pos/spec-doubledef-old.scala
+++ b/test/files/pos/spec-doubledef-old.scala
@@ -17,12 +17,12 @@ abstract class B[T, @specialized(scala.Int) U : Manifest, @specialized(scala.Int
val u: U
val v: V
- def f(t: T, v2: V): Pair[U, V] = {
+ def f(t: T, v2: V): Tuple2[U, V] = {
val m: Array[U] = null
if (m.isEmpty) {
- Pair(u, v)
+ (u, v)
} else {
- Pair(u, v2)
+ (u, v2)
}
}
}
diff --git a/test/files/pos/t0064.scala b/test/files/pos/t0064.scala
index c2ce4bf6d0..1eeca8dcad 100644
--- a/test/files/pos/t0064.scala
+++ b/test/files/pos/t0064.scala
@@ -1,6 +1,6 @@
object B {
def main(Args:Array[String]) = {
- val Pair(_,x) = Pair(1,2);
+ val (_,x) = (1,2);
x + 1;
}
}
diff --git a/test/files/pos/t247.scala b/test/files/pos/t247.scala
index e976404e61..fdcafeb2c6 100644
--- a/test/files/pos/t247.scala
+++ b/test/files/pos/t247.scala
@@ -16,11 +16,11 @@ class Tree[KEY,Entry](order:Order[KEY]) {
def size =0;
}
-class TreeMap[KEY,VALUE](_factory:TreeMapFactory[KEY]) extends Tree[KEY,Pair[KEY,VALUE]](_factory.order) with scala.collection.DefaultMap[KEY, VALUE] with Map[KEY, VALUE] {
+class TreeMap[KEY,VALUE](_factory:TreeMapFactory[KEY]) extends Tree[KEY,Tuple2[KEY,VALUE]](_factory.order) with scala.collection.DefaultMap[KEY, VALUE] with Map[KEY, VALUE] {
val factory = _factory
val order = _factory.order;
def this(newOrder:Order[KEY]) = this(new TreeMapFactory[KEY](newOrder));
def get(key:KEY) = null;
- def iterator:Iterator[Pair[KEY,VALUE]] = null;
+ def iterator:Iterator[Tuple2[KEY,VALUE]] = null;
override def size = super[Tree].size
}
diff --git a/test/files/pos/t443.scala b/test/files/pos/t443.scala
index 5b5e3ea828..cdaefe9ecd 100644
--- a/test/files/pos/t443.scala
+++ b/test/files/pos/t443.scala
@@ -1,10 +1,10 @@
object Test {
- def lookup(): Option[Pair[String, String]] =
- ((null: Option[Pair[String, String]]) : @unchecked) match {
- case Some(Pair(_, _)) =>
+ def lookup(): Option[Tuple2[String, String]] =
+ ((null: Option[Tuple2[String, String]]) : @unchecked) match {
+ case Some((_, _)) =>
if (true)
- Some(Pair(null, null))
+ Some((null, null))
else
lookup() match {
case Some(_) => Some(null)
diff --git a/test/files/pos/t4579.scala b/test/files/pos/t4579.scala
index 8951ec011f..cd1553f02a 100644
--- a/test/files/pos/t4579.scala
+++ b/test/files/pos/t4579.scala
@@ -190,10 +190,10 @@ object LispCaseClasses extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
@@ -381,10 +381,10 @@ object LispAny extends Lisp {
def extendEnv(env: Environment,
ps: List[String], args: List[Data]): Environment =
- Pair(ps, args) match {
- case Pair(List(), List()) =>
+ (ps, args) match {
+ case (List(), List()) =>
env
- case Pair(p :: ps1, arg :: args1) =>
+ case (p :: ps1, arg :: args1) =>
extendEnv(env.extend(p, arg), ps1, args1)
case _ =>
lispError("wrong number of arguments")
diff --git a/test/files/pos/t5120.scala b/test/files/pos/t5120.scala
index 6731af14e4..86d4470bd5 100644
--- a/test/files/pos/t5120.scala
+++ b/test/files/pos/t5120.scala
@@ -5,9 +5,9 @@ class Test {
class ScopedKey[T]
class Value[T]
- class Compiled[T](val settings: Seq[Pair[T]])
+ class Compiled[T](val settings: Seq[Tuple2[T]])
- case class Pair[T](k: ScopedKey[T], v: ScopedKey[T])
+ case class Tuple2[T](k: ScopedKey[T], v: ScopedKey[T])
def transform[T](x: T) = x
diff --git a/test/files/pos/t7987/Macro_1.scala b/test/files/pos/t7987/Macro_1.scala
new file mode 100644
index 0000000000..81f717b9c4
--- /dev/null
+++ b/test/files/pos/t7987/Macro_1.scala
@@ -0,0 +1,6 @@
+import scala.language.experimental._
+
+object Macro {
+ def apply[A](a: A): A = macro impl[A]
+ def impl[A](c: reflect.macros.Context)(a: c.Expr[A]): c.Expr[A] = a
+}
diff --git a/test/files/pos/t7987/Test_2.scala b/test/files/pos/t7987/Test_2.scala
new file mode 100644
index 0000000000..5896fdb517
--- /dev/null
+++ b/test/files/pos/t7987/Test_2.scala
@@ -0,0 +1,12 @@
+class C[T] {
+ def foo = 0
+}
+
+object Test {
+ implicit def AnyToC[T](a: Any): C[T] = new C[T]
+ // was: "macro not expanded"
+ Macro {
+ "".foo
+ ()
+ }
+}
diff --git a/test/files/pos/tcpoly_bounds1.scala b/test/files/pos/tcpoly_bounds1.scala
index 5874cc664d..63263cb152 100644
--- a/test/files/pos/tcpoly_bounds1.scala
+++ b/test/files/pos/tcpoly_bounds1.scala
@@ -1,7 +1,7 @@
-class Foo[t[x]<: Pair[Int, x]]
+class Foo[t[x]<: Tuple2[Int, x]]
//
-class MyPair[z](a: Int, b: z) extends Pair[Int, z](a,b)
+class MyPair[z](a: Int, b: z) extends Tuple2[Int, z](a,b)
object foo extends Foo[MyPair]
diff --git a/test/files/pos/typealiases.scala b/test/files/pos/typealiases.scala
index d03b521f77..93d1dce4dc 100644
--- a/test/files/pos/typealiases.scala
+++ b/test/files/pos/typealiases.scala
@@ -14,7 +14,7 @@ trait Test[T] {
object main extends Test[Int] {
val pair1 = (1,1)
- implicit def topair(x: Int): Pair[Int, Int] = (x,x)
+ implicit def topair(x: Int): Tuple2[Int, Int] = (x,x)
val pair2: MyPair[Int] = 1
val x: Short = 1
}
diff --git a/test/files/pos/unapplyNeedsMemberType.scala b/test/files/pos/unapplyNeedsMemberType.scala
index b423257e04..3a96e189af 100644
--- a/test/files/pos/unapplyNeedsMemberType.scala
+++ b/test/files/pos/unapplyNeedsMemberType.scala
@@ -19,7 +19,7 @@ class Join[a] extends Gunk[a] {
def append(s1: Seq, s2: Seq): Seq = s1 // mock implementation
def unapply_Cons(s: Any) = s match {
- case App(Cons(x, xs), ys) => Some(Pair(x, append(xs, ys)))
+ case App(Cons(x, xs), ys) => Some((x, append(xs, ys)))
case _ => null
}
}
diff --git a/test/files/pos/valdefs.scala b/test/files/pos/valdefs.scala
index 85ffa132b7..c8f78cd2bf 100644
--- a/test/files/pos/valdefs.scala
+++ b/test/files/pos/valdefs.scala
@@ -11,6 +11,6 @@ object test {
}
abstract class Sub2() extends Base() {
- override val Pair(x, y) = Pair("abc", 2.0);
+ override val (x, y) = ("abc", 2.0);
}
}
diff --git a/test/files/positions/ExcludedPrefix1.scala b/test/files/positions/ExcludedPrefix1.scala
index f3562c37f0..b3182eae78 100644
--- a/test/files/positions/ExcludedPrefix1.scala
+++ b/test/files/positions/ExcludedPrefix1.scala
@@ -35,7 +35,7 @@ object ExcludedPrefix1 {
(i,
j) = (0, 0)
- val Pair(
+ val (
k,
l) = (0, 0)
}
diff --git a/test/files/positions/Overlap4.scala b/test/files/positions/Overlap4.scala
index 0049293954..f54837295b 100644
--- a/test/files/positions/Overlap4.scala
+++ b/test/files/positions/Overlap4.scala
@@ -1,3 +1,3 @@
object Overlap4 {
- val Pair(a, b) = (0, 0)
+ val (a, b) = (0, 0)
}
diff --git a/test/files/positions/Scaladoc7.scala b/test/files/positions/Scaladoc7.scala
index 6175222e3f..0198d4d6ac 100644
--- a/test/files/positions/Scaladoc7.scala
+++ b/test/files/positions/Scaladoc7.scala
@@ -2,5 +2,5 @@ object Scaladoc7 {
/**
* Foo
*/
- val Pair(i, j) = (1, 2)
+ val (i, j) = (1, 2)
}
diff --git a/test/files/presentation/callcc-interpreter.check b/test/files/presentation/callcc-interpreter.check
index f031c52c86..1f868097ca 100644
--- a/test/files/presentation/callcc-interpreter.check
+++ b/test/files/presentation/callcc-interpreter.check
@@ -1,8 +1,8 @@
reload: CallccInterpreter.scala
-askTypeCompletion at CallccInterpreter.scala(51,38)
+askTypeCompletion at CallccInterpreter.scala(51,34)
================================================================================
-[response] askTypeCompletion at (51,38)
+[response] askTypeCompletion at (51,34)
retrieved 59 members
abstract trait Term extends AnyRef
abstract trait Value extends AnyRef
@@ -83,8 +83,8 @@ def showM(m: callccInterpreter.M[callccInterpreter.Value]): String = m.in.apply(
askType at CallccInterpreter.scala(50,30)
================================================================================
[response] askTypeAt (50,30)
-def add(a: callccInterpreter.Value, b: callccInterpreter.Value): callccInterpreter.M[_ >: callccInterpreter.Num with callccInterpreter.Wrong.type <: Product with Serializable with callccInterpreter.Value] = scala.this.Predef.Pair.apply[callccInterpreter.Value, callccInterpreter.Value](a, b) match {
- case scala.this.Predef.Pair.unapply[callccInterpreter.Value, callccInterpreter.Value](<unapply-selector>) <unapply> ((n: Int)callccInterpreter.Num((m @ _)), (n: Int)callccInterpreter.Num((n @ _))) => this.unitM[callccInterpreter.Num](callccInterpreter.this.Num.apply(m.+(n)))
+def add(a: callccInterpreter.Value, b: callccInterpreter.Value): callccInterpreter.M[_ >: callccInterpreter.Num with callccInterpreter.Wrong.type <: Product with Serializable with callccInterpreter.Value] = scala.Tuple2.apply[callccInterpreter.Value, callccInterpreter.Value](a, b) match {
+ case (_1: callccInterpreter.Value, _2: callccInterpreter.Value)(callccInterpreter.Value, callccInterpreter.Value)((n: Int)callccInterpreter.Num((m @ _)), (n: Int)callccInterpreter.Num((n @ _))) => this.unitM[callccInterpreter.Num](callccInterpreter.this.Num.apply(m.+(n)))
case _ => callccInterpreter.this.unitM[callccInterpreter.Wrong.type](callccInterpreter.this.Wrong)
}
================================================================================
diff --git a/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala b/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala
index ce3b996b96..d498fe0b17 100644
--- a/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala
+++ b/test/files/presentation/callcc-interpreter/src/CallccInterpreter.scala
@@ -40,15 +40,15 @@ object callccInterpreter {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]]
+ type Environment = List[Tuple2[Name, Value]]
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value) /*?*/ = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => this./*!*/unitM(Num(m + n))
+ def add(a: Value, b: Value) /*?*/ = (a, b) match {
+ case (Num(m), Num(n)) => this./*!*/unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -60,16 +60,20 @@ object callccInterpreter {
def interp(t: Term, e: Environment): M[Value] = t match {
case Var(x) => lookup(x, e)
case Con(n) => unitM(Num(n))
- case Add(l, r) => for (val a <- interp(l, e);
- val b <- interp(r, e);
- val c <- add(a, b))
- yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
- case App(f, t) => for (val a <- interp(f, e);
- val b <- interp(t, e);
- val c <- apply(a, b))
- yield c
- case Ccc(x, t) => callCC(k => interp(t, Pair(x, Fun(k)) :: e))
+ case Add(l, r) =>
+ for {
+ a <- interp(l, e)
+ b <- interp(r, e)
+ c <- add(a, b)
+ } yield c
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
+ case App(f, t) =>
+ for {
+ a <- interp(f, e)
+ b <- interp(t, e)
+ c <- apply(a, b)
+ } yield c
+ case Ccc(x, t) => callCC(k => interp(t, (x, Fun(k)) :: e))
}
def test(t: Term): String = showM(interp(t, List()))
diff --git a/test/files/run/Course-2002-05.scala b/test/files/run/Course-2002-05.scala
index e6764b92c8..80317bc757 100644
--- a/test/files/run/Course-2002-05.scala
+++ b/test/files/run/Course-2002-05.scala
@@ -3,15 +3,15 @@
//############################################################################
object M0 {
- def partition[a](xs: List[a], pred: a => Boolean): Pair[List[a], List[a]] = {
+ def partition[a](xs: List[a], pred: a => Boolean): Tuple2[List[a], List[a]] = {
if (xs.isEmpty)
- Pair(List(),List())
+ (List(),List())
else {
val tailPartition = partition(xs.tail, pred);
if (pred(xs.head))
- Pair(xs.head :: tailPartition._1, tailPartition._2)
+ (xs.head :: tailPartition._1, tailPartition._2)
else
- Pair(tailPartition._1, xs.head :: tailPartition._2)
+ (tailPartition._1, xs.head :: tailPartition._2)
}
}
@@ -49,9 +49,9 @@ object M0 {
//############################################################################
object M1 {
- def partition[a](xs: List[a], pred: a => Boolean): Pair[List[a], List[a]] = {
- xs.foldRight[Pair[List[a], List[a]]](Pair(List(), List())) {
- (x, p) => if (pred (x)) Pair(x :: p._1, p._2) else Pair(p._1, x :: p._2)
+ def partition[a](xs: List[a], pred: a => Boolean): Tuple2[List[a], List[a]] = {
+ xs.foldRight[Tuple2[List[a], List[a]]]((List(), List())) {
+ (x, p) => if (pred (x)) (x :: p._1, p._2) else (p._1, x :: p._2)
}
}
@@ -136,7 +136,7 @@ object M3 {
def adjoinRow(placement: Placement): List[Placement] =
range(1, n)
.filter (column => isSafe(column, placement))
- .map (column => Pair(row, column) :: placement);
+ .map (column => (row, column) :: placement);
placeQueens(row - 1) flatMap adjoinRow
}
diff --git a/test/files/run/Course-2002-06.scala b/test/files/run/Course-2002-06.scala
index e4fb86a966..908a934041 100644
--- a/test/files/run/Course-2002-06.scala
+++ b/test/files/run/Course-2002-06.scala
@@ -55,7 +55,7 @@ abstract class Graphics(_width: Double, _height: Double) {
}
/** Draw a list of segments on the picture.*/
- def drawSegments(frm: Frame)(segments: List[Pair[Vector, Vector]]): Unit =
+ def drawSegments(frm: Frame)(segments: List[Tuple2[Vector, Vector]]): Unit =
if (segments.isEmpty) ()
else {
drawSegment(frm)(segments.head._1, segments.head._2);
diff --git a/test/files/run/Course-2002-07.scala b/test/files/run/Course-2002-07.scala
index 055ff74d81..2d9457653f 100644
--- a/test/files/run/Course-2002-07.scala
+++ b/test/files/run/Course-2002-07.scala
@@ -181,10 +181,10 @@ object M4 {
object M5 {
- def zipFun[a,b](xs:List[a], ys:List[b]):List[Pair[a,b]] = Pair(xs,ys) match {
- case Pair(List(), _) => List()
- case Pair(_, List()) => List()
- case Pair(x :: xs1, y :: ys1) => Pair(x, y) :: zipFun(xs1, ys1)
+ def zipFun[a,b](xs:List[a], ys:List[b]):List[Tuple2[a,b]] = (xs,ys) match {
+ case (List(), _) => List()
+ case (_, List()) => List()
+ case (x :: xs1, y :: ys1) => (x, y) :: zipFun(xs1, ys1)
}
def test_zipFun[a,b](xs: List[a], ys: List[b]) = {
@@ -216,9 +216,9 @@ object M5 {
object M6 {
- def zipFun[a,b](xs:List[a], ys:List[b]):List[Pair[a,b]] = (Pair(xs,ys): @unchecked) match {
- // !!! case Pair(List(), _), Pair(_, List()) => List()
- case Pair(x :: xs1, y :: ys1) => Pair(x, y) :: zipFun(xs1, ys1)
+ def zipFun[a,b](xs:List[a], ys:List[b]):List[Tuple2[a,b]] = ((xs,ys): @unchecked) match {
+ // !!! case (List(), _), (_, List()) => List()
+ case (x :: xs1, y :: ys1) => (x, y) :: zipFun(xs1, ys1)
}
def test_zipFun[a,b](xs: List[a], ys: List[b]) = {
@@ -374,9 +374,9 @@ object M9 {
object MA {
- def lookup[k,v](xs: List[Pair[k,v]], k: k): v = xs match {
+ def lookup[k,v](xs: List[Tuple2[k,v]], k: k): v = xs match {
case List() => sys.error("no value for " + k)
- case Pair(k1,v1) :: xs1 => if (k1 == k) v1 else lookup(xs1, k)
+ case (k1,v1) :: xs1 => if (k1 == k) v1 else lookup(xs1, k)
}
trait Expr {
@@ -437,8 +437,8 @@ object MA {
val g1 = g0 derive x;
Console.println("g (x) = " + g0);
Console.println("g'(x) = " + g1);
- Console.println("g (3) = " + evalvars(List(Pair("x",3)))(g0));
- Console.println("g'(3) = " + evalvars(List(Pair("x",3)))(g1));
+ Console.println("g (3) = " + evalvars(List(("x",3)))(g0));
+ Console.println("g'(3) = " + evalvars(List(("x",3)))(g1));
Console.println;
}
@@ -453,26 +453,26 @@ object Utils {
if (y == 1) x else if (y % 2 == 0) power0(x*x,y/2) else x*power0(x, y-1);
def power(x: Int, y: Int): Int = (x,y) match {
- case Pair(0,0) => sys.error("power(0,0)")
- case Pair(0,_) => 0
- case Pair(1,_) => 1
- case Pair(_,0) => 1
- case Pair(_,1) => x
- case Pair(_,2) => x*x
- case Pair(_,_) => if (y < 0) 1/power0(x,y) else power0(x,y)
+ case (0,0) => sys.error("power(0,0)")
+ case (0,_) => 0
+ case (1,_) => 1
+ case (_,0) => 1
+ case (_,1) => x
+ case (_,2) => x*x
+ case (_,_) => if (y < 0) 1/power0(x,y) else power0(x,y)
}
def lookup(entries: List[(String,Int)], key: String): Int = entries match {
case List() => sys.error("no value for " + key)
- case Pair(k,v) :: _ if (k == key) => v
+ case (k,v) :: _ if (k == key) => v
case _ :: rest => lookup(rest, key)
}
def compare(xs: List[String], ys: List[String]): Int = (xs, ys) match {
- case Pair(List(), List()) => 0
- case Pair(List(), _ ) => -1
- case Pair(_ , List()) => +1
- case Pair(x::xs , y::ys ) => {
+ case (List(), List()) => 0
+ case (List(), _ ) => -1
+ case (_ , List()) => +1
+ case (x::xs , y::ys ) => {
val diff = x.compareTo(y);
if (diff != 0) diff else compare(xs,ys)
}
@@ -508,18 +508,18 @@ object MB {
private def +< (that: Expr): Boolean = (this +<? that) < 0;
private def +<= (that: Expr): Boolean = (this +<? that) <= 0;
- private def +<? (that: Expr): Int = Pair(this,that) match {
- case Pair(Add(_,_), _ ) => 0
- case Pair(_ , Add(_,_)) => 0
- case Pair(_ , _ ) => compare(this.vars,that.vars)
+ private def +<? (that: Expr): Int = (this,that) match {
+ case (Add(_,_), _ ) => 0
+ case (_ , Add(_,_)) => 0
+ case (_ , _ ) => compare(this.vars,that.vars)
}
- def + (that: Expr): Expr = if (that +<= this) Pair(this,that) match {
- case Pair(_ , Lit(0) ) => this
- case Pair(Lit(l) , Lit(r) ) => Lit(l + r)
- case Pair(_ , Add(rl,rr)) => (this + rl) + rr
- case Pair(Add(ll,lr), _ ) if (lr +<= that) => ll + (that + lr)
- case Pair(_ , _ ) => {
+ def + (that: Expr): Expr = if (that +<= this) (this,that) match {
+ case (_ , Lit(0) ) => this
+ case (Lit(l) , Lit(r) ) => Lit(l + r)
+ case (_ , Add(rl,rr)) => (this + rl) + rr
+ case (Add(ll,lr), _ ) if (lr +<= that) => ll + (that + lr)
+ case (_ , _ ) => {
val l = this.term;
val r = that.term;
if (l equ r) Lit(this.count + that.count) * r else Add(this, that)
@@ -528,41 +528,41 @@ object MB {
private def *< (that: Expr): Boolean = (this *<? that) < 0;
private def *<= (that: Expr): Boolean = (this *<? that) <= 0;
- private def *<? (that: Expr): Int = Pair(this,that) match {
- case Pair(Mul(_,_), _ ) => 0
- case Pair(_ , Mul(_,_)) => 0
- case Pair(Add(_,_), Add(_,_)) => 0
- case Pair(Add(_,_), _ ) => -1
- case Pair(_ , Add(_,_)) => +1
- case Pair(Lit(_) , Lit(_) ) => 0
- case Pair(Lit(_) , _ ) => -1
- case Pair(_ , Lit(_) ) => +1
- case Pair(Var(l) , Var(r) ) => l.compareTo(r)
- case Pair(Var(_) , Pow(r,_)) => if (this *<= r) -1 else +1
- case Pair(Pow(l,_), Var(_) ) => if (l *< that) -1 else +1
- case Pair(Pow(l,_), Pow(r,_)) => l *<? r
+ private def *<? (that: Expr): Int = (this,that) match {
+ case (Mul(_,_), _ ) => 0
+ case (_ , Mul(_,_)) => 0
+ case (Add(_,_), Add(_,_)) => 0
+ case (Add(_,_), _ ) => -1
+ case (_ , Add(_,_)) => +1
+ case (Lit(_) , Lit(_) ) => 0
+ case (Lit(_) , _ ) => -1
+ case (_ , Lit(_) ) => +1
+ case (Var(l) , Var(r) ) => l.compareTo(r)
+ case (Var(_) , Pow(r,_)) => if (this *<= r) -1 else +1
+ case (Pow(l,_), Var(_) ) => if (l *< that) -1 else +1
+ case (Pow(l,_), Pow(r,_)) => l *<? r
}
- def * (that: Expr): Expr = if (this *<= that) Pair(this,that) match {
- case Pair(Lit(0) , _ ) => this
- case Pair(Lit(1) , _ ) => that
- case Pair(Mul(ll,lr), r ) => ll * (lr * r)
- case Pair(Add(ll,lr), r ) => ll * r + lr * r
- case Pair(Lit(l) , Lit(r) ) => Lit(l * r)
- case Pair(Var(_) , Var(_) ) if (this equ that) => Pow(this,2)
- case Pair(Var(_) , Pow(r,n) ) if (this equ r) => Pow(this,n + 1)
- case Pair(Pow(ll,lr), Pow(rl,rr)) if (ll equ rl) => Pow(ll,lr + rr)
- case Pair(l , Mul(rl,rr)) if (rl *<= l) => (rl * l) * rr
- case Pair(_ , _ ) => Mul(this,that)
+ def * (that: Expr): Expr = if (this *<= that) (this,that) match {
+ case (Lit(0) , _ ) => this
+ case (Lit(1) , _ ) => that
+ case (Mul(ll,lr), r ) => ll * (lr * r)
+ case (Add(ll,lr), r ) => ll * r + lr * r
+ case (Lit(l) , Lit(r) ) => Lit(l * r)
+ case (Var(_) , Var(_) ) if (this equ that) => Pow(this,2)
+ case (Var(_) , Pow(r,n) ) if (this equ r) => Pow(this,n + 1)
+ case (Pow(ll,lr), Pow(rl,rr)) if (ll equ rl) => Pow(ll,lr + rr)
+ case (l , Mul(rl,rr)) if (rl *<= l) => (rl * l) * rr
+ case (_ , _ ) => Mul(this,that)
} else that * this;
def ^ (that: Int): Expr = (this,that) match {
- case Pair(_ ,1) => this
- case Pair(Lit(i) ,n) => Lit(power(i,n))
- case Pair(Var(_) ,n) => Pow(this,n)
- case Pair(Add(_,_),n) => this * (this ^ (n - 1))
- case Pair(Mul(l,r),n) => (l ^ n) * (r ^ n)
- case Pair(Pow(e,m),n) => Pow(e,m + n)
+ case (_ ,1) => this
+ case (Lit(i) ,n) => Lit(power(i,n))
+ case (Var(_) ,n) => Pow(this,n)
+ case (Add(_,_),n) => this * (this ^ (n - 1))
+ case (Mul(l,r),n) => (l ^ n) * (r ^ n)
+ case (Pow(e,m),n) => Pow(e,m + n)
}
def derive(v: Var): Expr = this match {
@@ -581,12 +581,12 @@ object MB {
case Pow(l, r) => power(l.evaluate(vars), r)
}
- def equ(that: Expr): Boolean = Pair(this,that) match {
- case Pair(Lit(l) ,Lit(r)) => l == r
- case Pair(Var(l) ,Var(r)) => l == r
- case Pair(Add(ll,lr),Add(rl,rr)) => (ll equ rl) && (lr equ rr)
- case Pair(Mul(ll,lr),Mul(rl,rr)) => (ll equ rl) && (lr equ rr)
- case Pair(Pow(ll,lr),Pow(rl,rr)) => (ll equ rl) && (lr == rr)
+ def equ(that: Expr): Boolean = (this,that) match {
+ case (Lit(l) ,Lit(r)) => l == r
+ case (Var(l) ,Var(r)) => l == r
+ case (Add(ll,lr),Add(rl,rr)) => (ll equ rl) && (lr equ rr)
+ case (Mul(ll,lr),Mul(rl,rr)) => (ll equ rl) && (lr equ rr)
+ case (Pow(ll,lr),Pow(rl,rr)) => (ll equ rl) && (lr == rr)
case _ => false
}
@@ -667,7 +667,7 @@ object MB {
Console.println;
def check(n: String, f: Expr, x: Int, e: Int) {
- val a: Int = f.evaluate(List(Pair("x",x)));
+ val a: Int = f.evaluate(List(("x",x)));
val s: String = if (a == e) "ok" else "KO(" + e + ")";
Console.println(n + "(" + x + ") = " + a + " " + s);
}
diff --git a/test/files/run/Course-2002-08.scala b/test/files/run/Course-2002-08.scala
index 38b8363661..5e21edaba3 100644
--- a/test/files/run/Course-2002-08.scala
+++ b/test/files/run/Course-2002-08.scala
@@ -163,7 +163,7 @@ object M5 {
}
abstract class Simulation() {
- private type Agenda = List[Pair[Int, Action]];
+ private type Agenda = List[Tuple2[Int, Action]];
private var agenda: Agenda = List();
private var curtime = 0;
def currentTime: Int = curtime;
@@ -171,17 +171,17 @@ object M5 {
def afterDelay(delay: Int)(action: Action): Unit = {
def insert(ag: Agenda, time: Int): Agenda = ag match {
case List() =>
- List(Pair(time, action))
- case Pair(t, act) :: ag1 =>
- if (time < t) Pair(time, action) :: ag
- else Pair(t, act) :: insert(ag1, time)
+ List((time, action))
+ case (t, act) :: ag1 =>
+ if (time < t) (time, action) :: ag
+ else (t, act) :: insert(ag1, time)
}
agenda = insert(agenda, curtime + delay)
}
private def next: Unit = agenda match {
case List() => ()
- case Pair(time, action) :: ag1 => {
+ case (time, action) :: ag1 => {
agenda = ag1;
curtime = time;
action();
@@ -413,7 +413,7 @@ object M5 {
class Simulator() {
type Action = () => Unit;
- type Agenda = List[Pair[Int, Action]];
+ type Agenda = List[Tuple2[Int, Action]];
private var agenda: Agenda = List();
private var curtime = 0;
@@ -421,17 +421,17 @@ class Simulator() {
def afterDelay(delay: Int)(action: Action) = {
def insert(ag: Agenda, time: Int): Agenda = ag match {
case List() =>
- List(Pair(time, action))
- case Pair(t, act) :: ag1 =>
- if (time < t) Pair(time, action) :: ag
- else Pair(t, act) :: insert(ag1, time)
+ List((time, action))
+ case (t, act) :: ag1 =>
+ if (time < t) (time, action) :: ag
+ else (t, act) :: insert(ag1, time)
}
agenda = insert(agenda, curtime + delay)
}
def next: Unit = agenda match {
case List() => ()
- case Pair(time, action) :: rest => {
+ case (time, action) :: rest => {
agenda = rest;
curtime = time;
action();
@@ -567,8 +567,8 @@ class Main() extends CircuitSimulator() {
demux(in, ctrl.reverse, out.reverse);
probe("in", in);
- for (Pair(x,c) <- range(0,n) zip ctrl) { probe("ctrl" + x, c) }
- for (Pair(x,o) <- range(0,outNum) zip out) { probe("out" + x, o) }
+ for ((x,c) <- range(0,n) zip ctrl) { probe("ctrl" + x, c) }
+ for ((x,o) <- range(0,outNum) zip out) { probe("out" + x, o) }
in.setSignal(true);
run;
diff --git a/test/files/run/Course-2002-09.scala b/test/files/run/Course-2002-09.scala
index 87f91111d8..704f2ec0aa 100644
--- a/test/files/run/Course-2002-09.scala
+++ b/test/files/run/Course-2002-09.scala
@@ -13,11 +13,11 @@ object NoConstraint extends Constraint {
}
class Adder(a1: Quantity,a2: Quantity,sum: Quantity) extends Constraint {
- def newValue = Triple(a1.getValue, a2.getValue, sum.getValue) match {
- case Triple(Some(x1), Some(x2), _ ) => sum.setValue(x1 + x2, this)
- case Triple(Some(x1), _ , Some(r)) => a2.setValue(r - x1, this)
- case Triple(_ , Some(x2), Some(r)) => a1.setValue(r - x2, this)
- case _ =>
+ def newValue = (a1.getValue, a2.getValue, sum.getValue) match {
+ case (Some(x1), Some(x2), _ ) => sum.setValue(x1 + x2, this)
+ case (Some(x1), _ , Some(r)) => a2.setValue(r - x1, this)
+ case (_ , Some(x2), Some(r)) => a1.setValue(r - x2, this)
+ case _ =>
}
def dropValue: Unit = {
a1.forgetValue(this); a2.forgetValue(this); sum.forgetValue(this);
@@ -29,13 +29,13 @@ class Adder(a1: Quantity,a2: Quantity,sum: Quantity) extends Constraint {
class Multiplier(m1: Quantity, m2: Quantity, prod: Quantity)
extends Constraint {
- def newValue = Triple(m1.getValue, m2.getValue, prod.getValue) match {
- case Triple(Some(0d), _ , _ ) => prod.setValue(0, this);
- case Triple(_ , Some(0d), _ ) => prod.setValue(0, this);
- case Triple(Some(x1), Some(x2), _ ) => prod.setValue(x1 * x2, this)
- case Triple(Some(x1), _ , Some(r)) => m2.setValue(r / x1, this)
- case Triple(_, Some(x2), Some(r)) => m1.setValue(r / x2, this)
- case _ =>
+ def newValue = (m1.getValue, m2.getValue, prod.getValue) match {
+ case (Some(0d), _ , _ ) => prod.setValue(0, this);
+ case (_ , Some(0d), _ ) => prod.setValue(0, this);
+ case (Some(x1), Some(x2), _ ) => prod.setValue(x1 * x2, this)
+ case (Some(x1), _ , Some(r)) => m2.setValue(r / x1, this)
+ case (_, Some(x2), Some(r)) => m1.setValue(r / x2, this)
+ case _ =>
}
def dropValue: Unit = {
m1.forgetValue(this); m2.forgetValue(this); prod.forgetValue(this);
@@ -46,11 +46,11 @@ class Multiplier(m1: Quantity, m2: Quantity, prod: Quantity)
}
class Squarer(square: Quantity, root: Quantity) extends Constraint {
- def newValue: Unit = Pair(square.getValue, root.getValue) match {
- case Pair(Some(x), _ )if (x < 0) => sys.error("Square of negative number")
- case Pair(Some(x), _ ) => root.setValue(Math.sqrt(x), this)
- case Pair(_ , Some(x)) => square.setValue(x*x, this)
- case _ =>
+ def newValue: Unit = (square.getValue, root.getValue) match {
+ case (Some(x), _ )if (x < 0) => sys.error("Square of negative number")
+ case (Some(x), _ ) => root.setValue(Math.sqrt(x), this)
+ case (_ , Some(x)) => square.setValue(x*x, this)
+ case _ =>
}
def dropValue: Unit = {
square.forgetValue(this); root.forgetValue(this);
@@ -60,9 +60,9 @@ class Squarer(square: Quantity, root: Quantity) extends Constraint {
}
class Eq(a: Quantity, b: Quantity) extends Constraint {
- def newValue = (Pair(a.getValue, b.getValue): @unchecked) match {
- case Pair(Some(x), _ ) => b.setValue(x, this);
- case Pair(_ , Some(y)) => a.setValue(y, this);
+ def newValue = ((a.getValue, b.getValue): @unchecked) match {
+ case (Some(x), _ ) => b.setValue(x, this);
+ case (_ , Some(y)) => a.setValue(y, this);
}
def dropValue {
a.forgetValue(this); b.forgetValue(this);
diff --git a/test/files/run/Course-2002-13.scala b/test/files/run/Course-2002-13.scala
index 4bd3614fb0..a596a33873 100644
--- a/test/files/run/Course-2002-13.scala
+++ b/test/files/run/Course-2002-13.scala
@@ -74,18 +74,18 @@ object Terms {
val NoTerm = Con("<none>", List());
- def unify1(x: Term, y: Term, s: Subst): Option[Subst] = Pair(x, y) match {
- case Pair(Var(a), Var(b)) if (a == b) =>
+ def unify1(x: Term, y: Term, s: Subst): Option[Subst] = (x, y) match {
+ case (Var(a), Var(b)) if (a == b) =>
Some(s)
- case Pair(Var(a), _) => lookup(s, a) match {
+ case (Var(a), _) => lookup(s, a) match {
case Some(x1) => unify(x1, y, s)
case None => if (y.tyvars contains a) None else Some(Binding(a, y) :: s)
}
- case Pair(_, Var(b)) => lookup(s, b) match {
+ case (_, Var(b)) => lookup(s, b) match {
case Some(y1) => unify(x, y1, s)
case None => if (x.tyvars contains b) None else Some(Binding(b, x) :: s)
}
- case Pair(Con(a, xs), Con(b, ys)) if (a == b) =>
+ case (Con(a, xs), Con(b, ys)) if (a == b) =>
unify(xs, ys, s)
case _ => None
}
@@ -96,9 +96,9 @@ object Terms {
ss
}
- def unify(xs: List[Term], ys: List[Term], s: Subst): Option[Subst] = Pair(xs, ys) match {
- case Pair(List(), List()) => Some(s)
- case Pair(x :: xs1, y :: ys1) =>
+ def unify(xs: List[Term], ys: List[Term], s: Subst): Option[Subst] = (xs, ys) match {
+ case (List(), List()) => Some(s)
+ case (x :: xs1, y :: ys1) =>
unify(x, y, s) match {
case Some(s1) => unify(xs1, ys1, s1)
case None => None
diff --git a/test/files/run/bugs.scala b/test/files/run/bugs.scala
index ba8449c299..02849b5817 100644
--- a/test/files/run/bugs.scala
+++ b/test/files/run/bugs.scala
@@ -46,7 +46,7 @@ object Bug135Test {
def test(args: Array[String]) {
val myMap:TreeMap[Int, String] = new TreeMap
- val map1 = myMap + Pair(42, "The answer")
+ val map1 = myMap + ((42, "The answer"))
println(map1.get(42))
}
diff --git a/test/files/run/ctries-old/main.scala b/test/files/run/ctries-old/main.scala
index f714bcdcdc..77161fed2f 100644
--- a/test/files/run/ctries-old/main.scala
+++ b/test/files/run/ctries-old/main.scala
@@ -38,7 +38,7 @@ trait Spec {
var produced = false
try body
catch {
- case e: Throwable => if (e.getClass == implicitly[ClassManifest[T]].erasure) produced = true
+ case e: Throwable => if (e.getClass == implicitly[ClassManifest[T]].runtimeClass) produced = true
} finally {
assert(produced, "Did not produce exception of type: " + implicitly[ClassManifest[T]])
}
diff --git a/test/files/run/getClassTest-old.scala b/test/files/run/getClassTest-old.scala
index 789dd4d162..cd1b6b07f6 100644
--- a/test/files/run/getClassTest-old.scala
+++ b/test/files/run/getClassTest-old.scala
@@ -53,7 +53,7 @@ class MoreAnyRefs {
@deprecated("Suppress warnings", since="2.11")
object Test {
def returnTypes[T: Manifest] = (
- manifest[T].erasure.getMethods.toList
+ manifest[T].runtimeClass.getMethods.toList
filter (_.getName startsWith "f")
sortBy (_.getName)
map (m => m.getName + ": " + m.getGenericReturnType.toString)
diff --git a/test/files/run/map_test.scala b/test/files/run/map_test.scala
index 1ea864ed58..b76dfb4577 100644
--- a/test/files/run/map_test.scala
+++ b/test/files/run/map_test.scala
@@ -20,7 +20,7 @@ object Test extends App {
val map2 = map1.updated(17,"A small random number")
val map3 = map2.updated(666,"A bigger random number")
val map4 = map3.updated(4711,"A big random number")
- map1 == myMap + Pair(42, "The answer")
+ map1 == myMap + ((42, "The answer"))
var i = 0
var map = map4
while(i < 43) {
diff --git a/test/files/run/patmatnew.scala b/test/files/run/patmatnew.scala
index b212e10f8d..3c0d00dc6c 100644
--- a/test/files/run/patmatnew.scala
+++ b/test/files/run/patmatnew.scala
@@ -46,7 +46,7 @@ object Test {
object SimpleUnapply {
def run() { // from sortedmap, old version
List((1, 2)).head match {
- case kv@Pair(key, _) => kv.toString + " " + key.toString
+ case kv@(key, _) => kv.toString + " " + key.toString
}
}
@@ -400,9 +400,9 @@ object Test {
// these are exhaustive matches
// should not generate any warnings
def f[A](z: (Option[A], Option[A])) = z match {
- case Pair(None, Some(x)) => 1
- case Pair(Some(x), None) => 2
- case Pair(Some(x), Some(y)) => 3
+ case (None, Some(x)) => 1
+ case (Some(x), None) => 2
+ case (Some(x), Some(y)) => 3
case _ => 4
}
@@ -419,9 +419,9 @@ object Test {
}
def h[A](x: (Option[A], Option[A])) = x match {
- case Pair(None, _: Some[_]) => 1
- case Pair(_: Some[_], None) => 2
- case Pair(_: Some[_], _: Some[_]) => 3
+ case (None, _: Some[_]) => 1
+ case (_: Some[_], None) => 2
+ case (_: Some[_], _: Some[_]) => 3
case _ => 4
}
@@ -539,17 +539,17 @@ object Test {
case class Operator(x: Int);
val EQ = new Operator(2);
- def analyze(x: Pair[Operator, Int]) = x match {
- case Pair(EQ, 0) => "0"
- case Pair(EQ, 1) => "1"
- case Pair(EQ, 2) => "2"
+ def analyze(x: Tuple2[Operator, Int]) = x match {
+ case (EQ, 0) => "0"
+ case (EQ, 1) => "1"
+ case (EQ, 2) => "2"
}
def run() {
- val x = Pair(EQ, 0);
+ val x = (EQ, 0);
assertEquals("0", analyze(x)); // should print "0"
- val y = Pair(EQ, 1);
+ val y = (EQ, 1);
assertEquals("1", analyze(y)); // should print "1"
- val z = Pair(EQ, 2);
+ val z = (EQ, 2);
assertEquals("2", analyze(z)); // should print "2"
}
}
diff --git a/test/files/run/t3888.scala b/test/files/run/t3888.scala
index 19771041fc..8701b42ff0 100644
--- a/test/files/run/t3888.scala
+++ b/test/files/run/t3888.scala
@@ -24,6 +24,6 @@ object Test {
}
}
-class P extends Pair(1, 1) {
+class P extends Tuple2(1, 1) {
override def equals(x: Any) = true
}
diff --git a/test/files/run/t6329_repl_bug.check b/test/files/run/t6329_repl_bug.check
new file mode 100644
index 0000000000..44c41cfd03
--- /dev/null
+++ b/test/files/run/t6329_repl_bug.check
@@ -0,0 +1,17 @@
+Type in expressions to have them evaluated.
+Type :help for more information.
+
+scala> import scala.reflect.runtime.universe._
+import scala.reflect.runtime.universe._
+
+scala> import scala.reflect.runtime._
+import scala.reflect.runtime._
+
+scala> classManifest[List[_]]
+warning: there were 1 deprecation warning(s); re-run with -deprecation for details
+res0: scala.reflect.ClassTag[List[_]] = scala.collection.immutable.List[<?>]
+
+scala> scala.reflect.classTag[List[_]]
+res1: scala.reflect.ClassTag[List[_]] = scala.collection.immutable.List
+
+scala>
diff --git a/test/files/run/t6329_repl_bug.pending b/test/files/run/t6329_repl_bug.scala
index 9997d1771e..9997d1771e 100644
--- a/test/files/run/t6329_repl_bug.pending
+++ b/test/files/run/t6329_repl_bug.scala
diff --git a/test/files/run/t6329_vanilla_bug.check b/test/files/run/t6329_vanilla_bug.check
new file mode 100644
index 0000000000..640d168a8a
--- /dev/null
+++ b/test/files/run/t6329_vanilla_bug.check
@@ -0,0 +1,3 @@
+warning: there were 1 deprecation warning(s); re-run with -deprecation for details
+scala.collection.immutable.List[<?>]
+scala.collection.immutable.List
diff --git a/test/files/run/t6329_vanilla_bug.pending b/test/files/run/t6329_vanilla_bug.scala
index 404f90bf6e..404f90bf6e 100644
--- a/test/files/run/t6329_vanilla_bug.pending
+++ b/test/files/run/t6329_vanilla_bug.scala
diff --git a/test/files/run/tailcalls.scala b/test/files/run/tailcalls.scala
index e5d8891cc7..1653b14de9 100644
--- a/test/files/run/tailcalls.scala
+++ b/test/files/run/tailcalls.scala
@@ -169,7 +169,7 @@ class TailCall[S](s: S) {
aux[T](x, y);
}
final def g3[T](x: Int, y: Int, zs: List[T]): Int = {
- def aux[U](n: Int, v: Int, ls: List[Pair[T,U]]): Int =
+ def aux[U](n: Int, v: Int, ls: List[Tuple2[T,U]]): Int =
if (n == 0) v else aux(n - 1, v - 1, ls);
aux(x, y, Nil);
}
diff --git a/test/files/run/tcpoly_parseridioms.check b/test/files/run/tcpoly_parseridioms.check
index ab829e0a0e..8bd0a086d6 100644
--- a/test/files/run/tcpoly_parseridioms.check
+++ b/test/files/run/tcpoly_parseridioms.check
@@ -4,8 +4,8 @@ It would fail on the following input: ParseResult()
^
tcpoly_parseridioms.scala:17: warning: match may not be exhaustive.
It would fail on the following input: ParseResult()
- def apply(in: Input): ParseResult[Pair[T, U]] = a(in) match {
- ^
+ def apply(in: Input): ParseResult[Tuple2[T, U]] = a(in) match {
+ ^
tcpoly_parseridioms.scala:30: warning: match may not be exhaustive.
It would fail on the following input: ParseResult()
case Failure(_, _) => b(in) match {
diff --git a/test/files/run/tcpoly_parseridioms.scala b/test/files/run/tcpoly_parseridioms.scala
index c8bcf693a1..d22f68b558 100644
--- a/test/files/run/tcpoly_parseridioms.scala
+++ b/test/files/run/tcpoly_parseridioms.scala
@@ -13,10 +13,10 @@ trait Parsers {
}
// sequence
- def sq[T, U](a: => Parser[T], b: => Parser[U]): Parser[Pair[T, U]] = new Parser[Pair[T, U]] {
- def apply(in: Input): ParseResult[Pair[T, U]] = a(in) match {
+ def sq[T, U](a: => Parser[T], b: => Parser[U]): Parser[Tuple2[T, U]] = new Parser[Tuple2[T, U]] {
+ def apply(in: Input): ParseResult[Tuple2[T, U]] = a(in) match {
case Success(next, x) => b(next) match {
- case Success(next2, y) => Success(next2, Pair(x,y))
+ case Success(next2, y) => Success(next2, (x,y))
case Failure(_, msg) => Failure(in, msg)
}
case Failure(_, msg) => Failure(in, msg)
@@ -49,7 +49,7 @@ trait Parsers {
}
}
- def apply_++[s, tt](fun: Parser[s => tt], arg: Parser[s]): Parser[tt] = lift[Pair[s=>tt, s], tt]({case Pair(f, a) => f(a)})(sq(fun, arg))
+ def apply_++[s, tt](fun: Parser[s => tt], arg: Parser[s]): Parser[tt] = lift[Tuple2[s=>tt, s], tt]({case (f, a) => f(a)})(sq(fun, arg))
def success[u](v: u): Parser[u] = new Parser[u] {
def apply(in: Input) = Success(in, v)
diff --git a/test/files/run/withIndex.scala b/test/files/run/withIndex.scala
index 910b1f1f9e..ebf1941c95 100644
--- a/test/files/run/withIndex.scala
+++ b/test/files/run/withIndex.scala
@@ -11,7 +11,7 @@ object Test {
Console.println(str.zipWithIndex.toList)
assert {
ary.zipWithIndex match {
- case _: Array[Pair[_,_]] => true
+ case _: Array[Tuple2[_,_]] => true
case _ => false
}
}
diff --git a/test/files/scalacheck/CheckCollections.scala b/test/files/scalacheck/CheckCollections.scala
index 108040b900..329d505b47 100644
--- a/test/files/scalacheck/CheckCollections.scala
+++ b/test/files/scalacheck/CheckCollections.scala
@@ -1,4 +1,4 @@
-import org.scalacheck.{ ConsoleReporter, Properties }
+import org.scalacheck.Properties
import org.scalacheck.Prop._
import scala.reflect.internal.util.Collections._
@@ -49,11 +49,4 @@ object Test extends Properties("reflect.internal.util.Collections") {
for {
(label, prop) <- tests
} property(label) = prop
-
- import org.scalacheck.{ Test => STest }
-
- def runTests() =
- STest.checkProperties(
- STest.Params(testCallback = ConsoleReporter(0)), this)
-
}
diff --git a/test/files/scalacheck/CheckEither.scala b/test/files/scalacheck/CheckEither.scala
index 4d0cab4693..48f732a22d 100644
--- a/test/files/scalacheck/CheckEither.scala
+++ b/test/files/scalacheck/CheckEither.scala
@@ -1,10 +1,8 @@
-import org.scalacheck.{ Arbitrary, ConsoleReporter, Prop, Properties }
+import org.scalacheck.{ Arbitrary, Prop, Properties }
import org.scalacheck.Arbitrary.{arbitrary, arbThrowable}
import org.scalacheck.Gen.oneOf
-import org.scalacheck.util.StdRand
import org.scalacheck.Prop._
-import org.scalacheck.Test.{Params, check}
-import org.scalacheck.ConsoleReporter.testStatsEx
+import org.scalacheck.Test.check
import Function.tupled
object Test extends Properties("Either") {
@@ -178,10 +176,4 @@ object Test extends Properties("Either") {
for ((label, prop) <- tests) {
property(label) = prop
}
-
- import org.scalacheck.{ Test => STest }
-
- def runTests() = {
- STest.checkProperties(STest.Params(testCallback = ConsoleReporter(0)), this)
- }
}
diff --git a/test/files/scalacheck/array-new.scala b/test/files/scalacheck/array-new.scala
index e13a47a5d5..d8c69ead78 100644
--- a/test/files/scalacheck/array-new.scala
+++ b/test/files/scalacheck/array-new.scala
@@ -1,4 +1,4 @@
-import scala.reflect.{ClassTag, classTag}
+import scala.reflect.ClassTag // new style: use ClassTag
import org.scalacheck._
import Prop._
import Gen._
diff --git a/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala b/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala
index c4b93dae48..7905a2ca15 100644
--- a/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala
+++ b/test/files/scalacheck/quasiquotes/ArbitraryTreesAndNames.scala
@@ -222,7 +222,7 @@ trait ArbitraryTreesAndNames {
yield ValDef(mods, name, tpt, rhs)
def genTree(size: Int): Gen[Tree] =
- if (size <= 1) oneOf(EmptyTree, genTreeIsTerm(size), genTreeIsType(size))
+ if (size <= 1) oneOf(EmptyTree: Gen[Tree], genTreeIsTerm(size), genTreeIsType(size))
else oneOf(genTree(1),
// these trees are neither terms nor types
genPackageDef(size - 1), genModuleDef(size - 1),
@@ -273,8 +273,8 @@ trait ArbitraryTreesAndNames {
def apply(universe: Universe, value: TreeIsType): universe.Tree =
value.tree.asInstanceOf[universe.Tree]
}
- implicit def treeIsTerm2tree(tit: TreeIsTerm) = tit.tree
- implicit def treeIsType2tree(tit: TreeIsType) = tit.tree
+ implicit def treeIsTerm2tree(tit: TreeIsTerm): Tree = tit.tree
+ implicit def treeIsType2tree(tit: TreeIsType): Tree = tit.tree
implicit val arbConstant: Arbitrary[Constant] = Arbitrary(genConstant)
implicit val arbModifiers: Arbitrary[Modifiers] = Arbitrary(genModifiers)
diff --git a/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala b/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala
index b2bce124ee..b331c4b6b6 100644
--- a/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala
+++ b/test/files/scalacheck/quasiquotes/QuasiquoteProperties.scala
@@ -18,13 +18,12 @@ trait Helpers {
object simplify extends Transformer {
object SimplifiedName {
- def unapply[T <: Name](name: T): Option[T] =
- name.toString.split("\\$").toSeq match {
- case first :+ last if scala.util.Try(last.toInt).isSuccess && first.nonEmpty =>
- val value = first.mkString("", "$", "$")
- Some((if (name.isTermName) TermName(value) else TypeName(value)).asInstanceOf[T])
- case _ => None
- }
+ val st = scala.reflect.runtime.universe.asInstanceOf[scala.reflect.internal.SymbolTable]
+ val FreshName = new st.FreshNameExtractor
+ def unapply[T <: Name](name: T): Option[T] = name.asInstanceOf[st.Name] match {
+ case FreshName(prefix) =>
+ Some((if (name.isTermName) TermName(prefix) else TypeName(prefix)).asInstanceOf[T])
+ }
}
override def transform(tree: Tree): Tree = tree match {
@@ -59,7 +58,7 @@ trait Helpers {
}
def assertThrows[T <: AnyRef](f: => Any)(implicit manifest: Manifest[T]): Unit = {
- val clazz = manifest.erasure.asInstanceOf[Class[T]]
+ val clazz = manifest.runtimeClass.asInstanceOf[Class[T]]
val thrown =
try {
f
diff --git a/test/files/scalacheck/si4147.scala b/test/files/scalacheck/si4147.scala
index 05507b1b18..72f6e9afd5 100644
--- a/test/files/scalacheck/si4147.scala
+++ b/test/files/scalacheck/si4147.scala
@@ -1,8 +1,6 @@
import org.scalacheck.Prop.{forAll, throws}
import org.scalacheck.Properties
-import org.scalacheck.ConsoleReporter.testStatsEx
import org.scalacheck.Gen
-import org.scalacheck.ConsoleReporter
import collection.mutable
@@ -66,5 +64,5 @@ object Test extends Properties("Mutable TreeSet") {
}
property("ordering must not be null") =
- throws(mutable.TreeSet.empty[Int](null), classOf[NullPointerException])
+ throws(classOf[NullPointerException])(mutable.TreeSet.empty[Int](null))
}
diff --git a/test/files/scalacheck/t2460.scala b/test/files/scalacheck/t2460.scala
index 196b43789f..ab2911447a 100644
--- a/test/files/scalacheck/t2460.scala
+++ b/test/files/scalacheck/t2460.scala
@@ -1,6 +1,5 @@
import org.scalacheck.Prop.forAll
import org.scalacheck.Properties
-import org.scalacheck.ConsoleReporter.testStatsEx
import org.scalacheck.{Test => SCTest}
import org.scalacheck.Gen
@@ -25,8 +24,4 @@ object Test extends Properties("Regex : Ticket 2460") {
("numberOfGroup", numberOfGroup),
("nameOfGroup", nameOfGroup)
)
-
- /*tests foreach {
- case (name, p) => testStatsEx(name, SCTest.check(p))
- }*/
}
diff --git a/test/files/scalacheck/treeset.scala b/test/files/scalacheck/treeset.scala
index 7fca3ed5e4..4b9b77dd7e 100644
--- a/test/files/scalacheck/treeset.scala
+++ b/test/files/scalacheck/treeset.scala
@@ -151,5 +151,5 @@ object Test extends Properties("TreeSet") {
}
property("ordering must not be null") =
- throws(TreeSet.empty[Int](null), classOf[NullPointerException])
+ throws(classOf[NullPointerException])(TreeSet.empty[Int](null))
}
diff --git a/test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala b/test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala
new file mode 100644
index 0000000000..cf09abdfff
--- /dev/null
+++ b/test/junit/scala/tools/nsc/symtab/FreshNameExtractorTest.scala
@@ -0,0 +1,47 @@
+package scala.tools.nsc
+package symtab
+
+import org.junit.Assert._
+import org.junit.Test
+import org.junit.runner.RunWith
+import org.junit.runners.JUnit4
+
+import scala.tools.testing.AssertUtil.assertThrows
+import scala.reflect.internal.util.FreshNameCreator
+
+@RunWith(classOf[JUnit4])
+class FreshNameExtractorTest {
+ object symbolTable extends SymbolTableForUnitTesting
+ import symbolTable._
+
+ val prefixes = List("foo$", "x$", "bar", "bippy$baz$")
+
+ @Test
+ def extractionPreservesPrefix =
+ ("" :: prefixes).foreach { creatorPrefix =>
+ prefixes.foreach { newPrefix =>
+ val Creator = new FreshNameCreator(creatorPrefix)
+ val Extractor = new FreshNameExtractor(creatorPrefix)
+ val Extractor(extractedPrefix) = TermName(Creator.newName(newPrefix))
+ assertEquals(newPrefix, extractedPrefix)
+ }
+ }
+
+ @Test
+ def extractionFailsOnCreatorPrefixMismatch = {
+ val Creator = new FreshNameCreator(prefixes.head)
+ val Extractor = new FreshNameExtractor(prefixes.tail.head)
+ assertThrows[MatchError] {
+ val Extractor(_) = TermName(Creator.newName("foo"))
+ }
+ }
+
+ @Test
+ def extractionsFailsIfNameDoesntEndWithNumber = {
+ val Creator = new FreshNameCreator(prefixes.head)
+ val Extractor = new FreshNameExtractor(prefixes.head)
+ assertThrows[MatchError] {
+ val Extractor(_) = TermName(Creator.newName("foo") + "bar")
+ }
+ }
+} \ No newline at end of file
diff --git a/test/pending/run/reify_callccinterpreter.scala b/test/pending/run/reify_callccinterpreter.scala
index d9f7736769..82c70da28f 100644
--- a/test/pending/run/reify_callccinterpreter.scala
+++ b/test/pending/run/reify_callccinterpreter.scala
@@ -43,15 +43,15 @@ object Test extends App {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]];
+ type Environment = List[Tuple2[Name, Value]];
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -67,12 +67,12 @@ object Test extends App {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
yield c
- case Ccc(x, t) => callCC(k => interp(t, Pair(x, Fun(k)) :: e))
+ case Ccc(x, t) => callCC(k => interp(t, (x, Fun(k)) :: e))
}
def test(t: Term): String = showM(interp(t, List()))
diff --git a/test/pending/run/reify_simpleinterpreter.scala b/test/pending/run/reify_simpleinterpreter.scala
index 6cf87ea7c5..1f6d6c8da7 100644
--- a/test/pending/run/reify_simpleinterpreter.scala
+++ b/test/pending/run/reify_simpleinterpreter.scala
@@ -32,15 +32,15 @@ object Test extends App {
override def toString() = "<function>"
}
- type Environment = List[Pair[Name, Value]]
+ type Environment = List[Tuple2[Name, Value]]
def lookup(x: Name, e: Environment): M[Value] = e match {
case List() => unitM(Wrong)
- case Pair(y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
+ case (y, b) :: e1 => if (x == y) unitM(b) else lookup(x, e1)
}
- def add(a: Value, b: Value): M[Value] = Pair(a, b) match {
- case Pair(Num(m), Num(n)) => unitM(Num(m + n))
+ def add(a: Value, b: Value): M[Value] = (a, b) match {
+ case (Num(m), Num(n)) => unitM(Num(m + n))
case _ => unitM(Wrong)
}
@@ -56,7 +56,7 @@ object Test extends App {
b <- interp(r, e);
c <- add(a, b))
yield c
- case Lam(x, t) => unitM(Fun(a => interp(t, Pair(x, a) :: e)))
+ case Lam(x, t) => unitM(Fun(a => interp(t, (x, a) :: e)))
case App(f, t) => for (a <- interp(f, e);
b <- interp(t, e);
c <- apply(a, b))
diff --git a/test/pending/shootout/fasta.scala b/test/pending/shootout/fasta.scala
index 8b711083a5..ae99ba5936 100644
--- a/test/pending/shootout/fasta.scala
+++ b/test/pending/shootout/fasta.scala
@@ -5,7 +5,7 @@
import java.io._
-object fasta {
+object fasta {
def main(args: Array[String]) = {
val ALU =
@@ -18,31 +18,31 @@ object fasta {
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
val _IUB = Array(
- Pair('a', 0.27),
- Pair('c', 0.12),
- Pair('g', 0.12),
- Pair('t', 0.27),
-
- Pair('B', 0.02),
- Pair('D', 0.02),
- Pair('H', 0.02),
- Pair('K', 0.02),
- Pair('M', 0.02),
- Pair('N', 0.02),
- Pair('R', 0.02),
- Pair('S', 0.02),
- Pair('V', 0.02),
- Pair('W', 0.02),
- Pair('Y', 0.02)
+ ('a', 0.27),
+ ('c', 0.12),
+ ('g', 0.12),
+ ('t', 0.27),
+
+ ('B', 0.02),
+ ('D', 0.02),
+ ('H', 0.02),
+ ('K', 0.02),
+ ('M', 0.02),
+ ('N', 0.02),
+ ('R', 0.02),
+ ('S', 0.02),
+ ('V', 0.02),
+ ('W', 0.02),
+ ('Y', 0.02)
)
val IUB = makeCumulative(_IUB)
val _HomoSapiens = Array(
- Pair('a', 0.3029549426680),
- Pair('c', 0.1979883004921),
- Pair('g', 0.1975473066391),
- Pair('t', 0.3015094502008)
+ ('a', 0.3029549426680),
+ ('c', 0.1979883004921),
+ ('g', 0.1975473066391),
+ ('t', 0.3015094502008)
)
val HomoSapiens = makeCumulative(_HomoSapiens)
@@ -61,15 +61,15 @@ object fasta {
s.writeRandomSequence(HomoSapiens,n*5)
s.close
- }
+ }
- def makeCumulative(a: Array[Pair[Char,Double]]) = {
+ def makeCumulative(a: Array[Tuple2[Char,Double]]) = {
var cp = 0.0
a map (frequency =>
- frequency match {
- case Pair(code,percent) =>
- cp = cp + percent; new Frequency(code.toByte,cp)
- }
+ frequency match {
+ case (code,percent) =>
+ cp = cp + percent; new Frequency(code.toByte,cp)
+ }
)
}
@@ -79,7 +79,7 @@ object fasta {
// We could use instances of Pair or Tuple2 but specific labels
// make the code more readable than index numbers
-class Frequency(_code: Byte, _percent: Double){
+class Frequency(_code: Byte, _percent: Double){
var code = _code; var percent = _percent;
}
@@ -101,13 +101,13 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
val m = if (n < LineLength) n else LineLength
var i = 0
- while (i < m){
+ while (i < m){
if (k == kn) k = 0
val b = alu(k)
if (count < buf.length){ buf(count) = b; count = count + 1 }
else { write(b) } // flush buffer
k = k+1
- i = i+1
+ i = i+1
}
write(nl)
@@ -122,11 +122,11 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
val m = if (n < LineLength) n else LineLength
var i = 0
- while (i < m){
+ while (i < m){
val b = selectRandom(distribution)
if (count < buf.length){ buf(count) = b; count = count + 1 }
else { write(b) } // flush buffer
- i = i+1
+ i = i+1
}
if (count < buf.length){ buf(count) = nl; count = count + 1 }
diff --git a/test/pending/shootout/revcomp.scala-2.scala b/test/pending/shootout/revcomp.scala-2.scala
index 92260ad021..03fb25af1b 100644
--- a/test/pending/shootout/revcomp.scala-2.scala
+++ b/test/pending/shootout/revcomp.scala-2.scala
@@ -6,7 +6,7 @@
import java.io._
import scala.collection.mutable.Stack
-object revcomp {
+object revcomp {
val IUB = IUBCodeComplements
@@ -16,7 +16,7 @@ object revcomp {
val a: Array[Byte] = new Array( 'z'.toByte )
for (indexValue <- code zip comp)
- indexValue match { case Pair(i,v) => a(i) = v }
+ indexValue match { case (i,v) => a(i) = v }
a
}
@@ -49,18 +49,18 @@ object revcomp {
if (desc.length > 0) complementReverseWrite(desc, lines, w)
w.close
- }
+ }
- def complementReverseWrite(desc: String, lines: LineStack,
+ def complementReverseWrite(desc: String, lines: LineStack,
w: BufferedOutputStream) = {
def inplaceComplementReverse(b: Array[Byte]) = {
- var i = 0
+ var i = 0
var j = b.length - 1
while (i < j){
- val swap = b(i)
- b(i) = IUB( b(j) )
+ val swap = b(i)
+ b(i) = IUB( b(j) )
b(j) = IUB( swap )
i = i + 1
j = j - 1
@@ -79,11 +79,11 @@ object revcomp {
while (!lines.isEmpty) {
val line = lines.pop
inplaceComplementReverse(line)
-
+
if (isSplitLine){
if (isFirstLine){ w.write(line); isFirstLine = false }
else { w.write(line,0,n-k); w.write(nl); w.write(line,n-k,k) }
- }
+ }
else { w.write(line); w.write(nl) }
}
if (isSplitLine && !isFirstLine) w.write(nl)
diff --git a/test/pending/shootout/revcomp.scala-3.scala b/test/pending/shootout/revcomp.scala-3.scala
index ae12f0499b..39a0409127 100644
--- a/test/pending/shootout/revcomp.scala-3.scala
+++ b/test/pending/shootout/revcomp.scala-3.scala
@@ -6,7 +6,7 @@
import java.io._
import scala.collection.mutable.Stack
-object revcomp {
+object revcomp {
def main(args: Array[String]) = {
val out = new FastaOutputStream(System.out)
val in = new FastaInputStream(System.in)
@@ -17,12 +17,12 @@ object revcomp {
in.close
out.close
- }
+ }
}
trait FastaByteStream {
- val nl = '\n'.toByte
+ val nl = '\n'.toByte
type Line = Array[Byte]
type LineStack = Stack[Line]
@@ -31,13 +31,13 @@ trait FastaByteStream {
// extend the Java BufferedInputStream class
-final class FastaInputStream(in: InputStream)
+final class FastaInputStream(in: InputStream)
extends BufferedInputStream(in) with FastaByteStream {
val gt = '>'.toByte
val sc = ';'.toByte
- def readSequenceStack(): Pair[Line,LineStack] = {
+ def readSequenceStack(): Tuple2[Line,LineStack] = {
var header: Line = null
val lines: LineStack = new Stack
@@ -49,14 +49,14 @@ final class FastaInputStream(in: InputStream)
header = line
} else {
pos = pos - line.length - 1 // reposition to start of line
- return Pair(header,lines)
+ return (header,lines)
}
} else {
if (c != sc) lines push line // ';'
}
line = readLine()
}
- return Pair(header,lines)
+ return (header,lines)
}
def readLine() = {
@@ -65,7 +65,7 @@ final class FastaInputStream(in: InputStream)
else {
mark(128) // mark the start of the line
if (count == 0) read() // fill buffer
-
+
var i = markpos
while (i < count && buf(i) != nl) i = i + 1
@@ -74,11 +74,11 @@ final class FastaInputStream(in: InputStream)
while (i < count && buf(i) != nl) i = i + 1
}
- if (i < count){
+ if (i < count){
bytes = new Array(i - markpos)
System.arraycopy(buf, markpos, bytes, 0, i - markpos);
pos = i+1
- }
+ }
}
bytes
}
@@ -87,7 +87,7 @@ final class FastaInputStream(in: InputStream)
// extend the Java BufferedOutputStream class
-final class FastaOutputStream(in: OutputStream)
+final class FastaOutputStream(in: OutputStream)
extends BufferedOutputStream(in) with FastaByteStream {
private val IUB = IUBCodeComplements
@@ -98,19 +98,19 @@ final class FastaOutputStream(in: OutputStream)
val iub: Array[Byte] = new Array( 'z'.toByte )
for (indexValue <- code zip comp)
- indexValue match { case Pair(i,v) => iub(i) = v }
+ indexValue match { case (i,v) => iub(i) = v }
iub
}
- def writeReverseComplement(sequence: Pair[Line,LineStack]) = {
+ def writeReverseComplement(sequence: Tuple2[Line,LineStack]) = {
def inplaceComplementReverse(b: Array[Byte]) = {
- var i = 0
+ var i = 0
var j = b.length - 1
while (i < j){
- val swap = b(i)
- b(i) = IUB( b(j) )
+ val swap = b(i)
+ b(i) = IUB( b(j) )
b(j) = IUB( swap )
i = i + 1
j = j - 1
@@ -119,7 +119,7 @@ final class FastaOutputStream(in: OutputStream)
}
sequence match {
- case Pair(header,lines) => {
+ case (header,lines) => {
write(header); write(nl)
@@ -131,11 +131,11 @@ final class FastaOutputStream(in: OutputStream)
while (!lines.isEmpty) {
val line = lines.pop
inplaceComplementReverse(line)
-
+
if (isSplitLine){
- if (isFirstLine){ write(line); isFirstLine = false }
+ if (isFirstLine){ write(line); isFirstLine = false }
else { write(line,0,LineLength-k); write(nl); write(line,LineLength-k,k) }
- }
+ }
else { write(line); write(nl) }
}