1 files changed, 0 insertions, 162 deletions
diff --git a/test/pending/shootout/fasta.scala b/test/pending/shootout/fasta.scala
deleted file mode 100644
index ae99ba5936..0000000000
--- a/test/pending/shootout/fasta.scala
+++ /dev/null
@@ -1,162 +0,0 @@
-/* The Computer Language Shootout
-   http://shootout.alioth.debian.org/
-   contributed by Isaac Gouy
-*/
-
-import java.io._
-
-object fasta {
-   def main(args: Array[String]) = {
-
-      val ALU =
-         "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
-         "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
-         "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
-         "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
-         "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
-         "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
-         "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-      val _IUB = Array(
-         ('a', 0.27),
-         ('c', 0.12),
-         ('g', 0.12),
-         ('t', 0.27),
-
-         ('B', 0.02),
-         ('D', 0.02),
-         ('H', 0.02),
-         ('K', 0.02),
-         ('M', 0.02),
-         ('N', 0.02),
-         ('R', 0.02),
-         ('S', 0.02),
-         ('V', 0.02),
-         ('W', 0.02),
-         ('Y', 0.02)
-      )
-
-      val IUB = makeCumulative(_IUB)
-
-      val _HomoSapiens = Array(
-         ('a', 0.3029549426680),
-         ('c', 0.1979883004921),
-         ('g', 0.1975473066391),
-         ('t', 0.3015094502008)
-      )
-
-      val HomoSapiens = makeCumulative(_HomoSapiens)
-
-
-      val n = Integer parseInt(args(0))
-      val s = new FastaOutputStream(System.out)
-
-      s.writeDescription("ONE Homo sapiens alu")
-      s.writeRepeatingSequence(ALU,n*2)
-
-      s.writeDescription("TWO IUB ambiguity codes")
-      s.writeRandomSequence(IUB,n*3)
-
-      s.writeDescription("THREE Homo sapiens frequency")
-      s.writeRandomSequence(HomoSapiens,n*5)
-
-      s.close
-   }
-
-   def makeCumulative(a: Array[Tuple2[Char,Double]]) = {
-      var cp = 0.0
-      a map (frequency =>
-         frequency match {
-            case (code,percent) =>
-               cp = cp + percent; new Frequency(code.toByte,cp)
-         }
-      )
-   }
-
-}
-
-
-// We could use instances of Pair or Tuple2 but specific labels
-// make the code more readable than index numbers
-
-class Frequency(_code: Byte, _percent: Double){
-   var code = _code; var percent = _percent;
-}
-
-
-// extend the Java BufferedOutputStream class
-
-class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {
-
-   private val LineLength = 60
-   private val nl = '\n'.toByte
-
-   def writeDescription(desc: String) = { write( (">" + desc + "\n").getBytes ) }
-
-   def writeRepeatingSequence(_alu: String, length: Int) = {
-      val alu = _alu.getBytes
-      var n = length; var k = 0; val kn = alu.length;
-
-      while (n > 0) {
-         val m = if (n < LineLength) n else LineLength
-
-         var i = 0
-         while (i < m){
-            if (k == kn) k = 0
-            val b = alu(k)
-            if (count < buf.length){ buf(count) = b; count = count + 1 }
-            else { write(b) } // flush buffer
-            k = k+1
-            i = i+1
-         }
-
-         write(nl)
-         n = n - LineLength
-      }
-
-   }
-
-   def writeRandomSequence(distribution: Array[Frequency], length: Int) = {
-      var n = length
-      while (n > 0) {
-         val m = if (n < LineLength) n else LineLength
-
-         var i = 0
-         while (i < m){
-            val b = selectRandom(distribution)
-            if (count < buf.length){ buf(count) = b; count = count + 1 }
-            else { write(b) } // flush buffer
-            i = i+1
-         }
-
-         if (count < buf.length){ buf(count) = nl; count = count + 1 }
-         else { write(nl) } // flush buffer
-         n = n - LineLength
-      }
-   }
-
-   private def selectRandom(distribution: Array[Frequency]): Byte = {
-      val n = distribution.length
-      val r = RandomNumber scaledTo(1.0)
-
-      var i = 0
-      while (i < n) {
-         if (r < distribution(i).percent) return distribution(i).code
-         i = i+1
-      }
-      return distribution(n-1).code
-   }
-}
-
-
-object RandomNumber {
-   private val IM = 139968
-   private val IA = 3877
-   private val IC = 29573
-   private var seed = 42
-
-   def scaledTo(max: Double) = {
-      seed = (seed * IA + IC) % IM
-      max * seed / IM
-   }
-}