diff options
Diffstat (limited to 'test/pending/shootout/fasta.scala')
-rw-r--r-- | test/pending/shootout/fasta.scala | 64 |
1 files changed, 32 insertions, 32 deletions
diff --git a/test/pending/shootout/fasta.scala b/test/pending/shootout/fasta.scala index 8b711083a5..ae99ba5936 100644 --- a/test/pending/shootout/fasta.scala +++ b/test/pending/shootout/fasta.scala @@ -5,7 +5,7 @@ import java.io._ -object fasta { +object fasta { def main(args: Array[String]) = { val ALU = @@ -18,31 +18,31 @@ object fasta { "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" val _IUB = Array( - Pair('a', 0.27), - Pair('c', 0.12), - Pair('g', 0.12), - Pair('t', 0.27), - - Pair('B', 0.02), - Pair('D', 0.02), - Pair('H', 0.02), - Pair('K', 0.02), - Pair('M', 0.02), - Pair('N', 0.02), - Pair('R', 0.02), - Pair('S', 0.02), - Pair('V', 0.02), - Pair('W', 0.02), - Pair('Y', 0.02) + ('a', 0.27), + ('c', 0.12), + ('g', 0.12), + ('t', 0.27), + + ('B', 0.02), + ('D', 0.02), + ('H', 0.02), + ('K', 0.02), + ('M', 0.02), + ('N', 0.02), + ('R', 0.02), + ('S', 0.02), + ('V', 0.02), + ('W', 0.02), + ('Y', 0.02) ) val IUB = makeCumulative(_IUB) val _HomoSapiens = Array( - Pair('a', 0.3029549426680), - Pair('c', 0.1979883004921), - Pair('g', 0.1975473066391), - Pair('t', 0.3015094502008) + ('a', 0.3029549426680), + ('c', 0.1979883004921), + ('g', 0.1975473066391), + ('t', 0.3015094502008) ) val HomoSapiens = makeCumulative(_HomoSapiens) @@ -61,15 +61,15 @@ object fasta { s.writeRandomSequence(HomoSapiens,n*5) s.close - } + } - def makeCumulative(a: Array[Pair[Char,Double]]) = { + def makeCumulative(a: Array[Tuple2[Char,Double]]) = { var cp = 0.0 a map (frequency => - frequency match { - case Pair(code,percent) => - cp = cp + percent; new Frequency(code.toByte,cp) - } + frequency match { + case (code,percent) => + cp = cp + percent; new Frequency(code.toByte,cp) + } ) } @@ -79,7 +79,7 @@ object fasta { // We could use instances of Pair or Tuple2 but specific labels // make the code more readable than index numbers -class Frequency(_code: Byte, _percent: Double){ +class Frequency(_code: Byte, _percent: Double){ var code = _code; var percent = _percent; } @@ -101,13 +101,13 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) { val m = if (n < LineLength) n else LineLength var i = 0 - while (i < m){ + while (i < m){ if (k == kn) k = 0 val b = alu(k) if (count < buf.length){ buf(count) = b; count = count + 1 } else { write(b) } // flush buffer k = k+1 - i = i+1 + i = i+1 } write(nl) @@ -122,11 +122,11 @@ class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) { val m = if (n < LineLength) n else LineLength var i = 0 - while (i < m){ + while (i < m){ val b = selectRandom(distribution) if (count < buf.length){ buf(count) = b; count = count + 1 } else { write(b) } // flush buffer - i = i+1 + i = i+1 } if (count < buf.length){ buf(count) = nl; count = count + 1 } |